ID: 1059093665

View in Genome Browser
Species Human (GRCh38)
Location 9:111389315-111389337
Sequence GTCCACTGGGAAGATGGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059093665_1059093669 -1 Left 1059093665 9:111389315-111389337 CCTTAACCATCTTCCCAGTGGAC 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1059093669 9:111389337-111389359 CATTTATATTGTTTCCCTTTTGG 0: 1
1: 0
2: 5
3: 104
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059093665 Original CRISPR GTCCACTGGGAAGATGGTTA AGG (reversed) Intronic
901126695 1:6934445-6934467 GTGCCCTGGGAGGATGGGTAAGG + Intronic
901731854 1:11285740-11285762 GACCAGTGGGAAGATGGCCAGGG - Exonic
903655785 1:24948109-24948131 GTCCACTGGGTGGATGCTTCTGG - Intronic
904933709 1:34111371-34111393 GTCTGGTGGGGAGATGGTTATGG - Intronic
906913106 1:49977769-49977791 ATCCACTGCATAGATGGTTAGGG + Intronic
909338566 1:74505570-74505592 GTCCACATGGAAGATGTTAAAGG - Intronic
910474194 1:87589369-87589391 GTACTCTGGGAAGTTGGTTTGGG - Intergenic
911687352 1:100792538-100792560 GTCCACTGGGAGGCTGGAGAGGG + Intergenic
914327601 1:146635528-146635550 GCCCAAATGGAAGATGGTTAAGG - Intergenic
917922223 1:179760093-179760115 AGCCAGTTGGAAGATGGTTATGG + Intronic
917923135 1:179767355-179767377 GTGCCCTGGGAAGATGTTCAGGG + Intronic
919619197 1:199846157-199846179 GTTCACTGGAAAAATGGTGATGG - Intergenic
1063569908 10:7205864-7205886 GCCCACTGGGAAGATGTCCATGG + Exonic
1065536877 10:26723418-26723440 GTCAACTGGGGAGATGGACATGG + Intronic
1066012331 10:31206404-31206426 AGCCACTGGGAAGCTGCTTATGG - Intergenic
1069537790 10:69267900-69267922 GTCCACTGGAGAAATGGTCAGGG - Intergenic
1071308311 10:84319604-84319626 GGCAAATGGGAAGATGGTGAAGG - Intergenic
1072492848 10:95925174-95925196 TGCCACTGTGCAGATGGTTAGGG + Intronic
1073140452 10:101243663-101243685 GTCCATTGGGTAGACGGTTAGGG - Intergenic
1076797334 10:132804598-132804620 CTCCTCTGGGAAGATCATTAAGG + Intergenic
1077018618 11:407637-407659 GTGCACGTGGGAGATGGTTAGGG - Intronic
1078997672 11:16720938-16720960 GTTCACTGGGAAGATGCTACTGG - Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1084562784 11:69913794-69913816 GTTCACTGGGCAGATGGTGACGG + Intergenic
1085457237 11:76671993-76672015 GTCCACTGTGGAGATGGATCTGG + Intergenic
1086476127 11:87176647-87176669 GTCCATGGGAAAGATTGTTAAGG + Intronic
1087245841 11:95835800-95835822 GTCTACTGTGAATATGTTTATGG - Intronic
1088866589 11:113853533-113853555 GACCAGTGATAAGATGGTTAGGG - Intronic
1090110364 11:123901181-123901203 GTACACTGGGAGAATAGTTAAGG + Intergenic
1091182949 11:133623433-133623455 GTGCAATGGGAAGATGGCAAGGG + Intergenic
1094006702 12:25760966-25760988 GTTCCCTGGGAATAAGGTTAAGG + Intergenic
1095257587 12:40057583-40057605 AACCACTGGAAAAATGGTTAAGG - Intronic
1096053642 12:48632638-48632660 CTCCTCTGGAAAGATGATTAAGG + Intergenic
1099752676 12:86798034-86798056 AGCAACTGGTAAGATGGTTATGG - Intronic
1101270700 12:103141002-103141024 ATTTACTTGGAAGATGGTTAAGG - Intergenic
1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG + Intergenic
1106926551 13:34619104-34619126 GTCCTCTGGCAAAATGGTTAGGG + Intergenic
1108009401 13:45988957-45988979 GTCCGCTGATAAGATGGTGAAGG + Exonic
1108415339 13:50192668-50192690 GTCCACTGGGAAGAAGGGAATGG + Intronic
1111357689 13:87130176-87130198 GTCAACTTGGAAGATGTTTTTGG - Intergenic
1118247915 14:64129616-64129638 GACCTCTGGCAAGATTGTTAAGG + Intronic
1121622181 14:95357980-95358002 GTCAACTGGGAGCATGGCTAAGG + Intergenic
1121963088 14:98279105-98279127 TTCCCCTGGCAAGAAGGTTAGGG + Intergenic
1125727479 15:41875435-41875457 GTCCACTGGGAAGAGGGACAGGG - Intronic
1125781743 15:42274816-42274838 GACCACTGGGAGGATGGATTTGG + Intronic
1126405568 15:48319461-48319483 GTCCACTGGGCAGGTGATTTGGG - Intergenic
1127742928 15:61931172-61931194 CTCCTCAGGGAAGATGTTTAAGG - Exonic
1128240025 15:66095556-66095578 GCCCACTGGGAAGATGCTGTTGG + Intronic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1137036948 16:35575836-35575858 TTCCCCTGGGAAGATGATTCAGG + Intergenic
1138132286 16:54490795-54490817 GCACACTGGGAAGAAGGTTCTGG - Intergenic
1140005958 16:71075412-71075434 GCCCAAATGGAAGATGGTTAAGG + Intronic
1140964086 16:79947284-79947306 GCCTTCTGGGAAGATGGTGAGGG + Intergenic
1141278074 16:82606094-82606116 GTCCAGGGGGAAGAGGGCTAAGG - Intergenic
1148393994 17:47294283-47294305 GACCCCTGGGAAGAAGGTTGGGG + Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1150608083 17:66711558-66711580 CTCTTCTGGGAAGCTGGTTAGGG + Intronic
1152593877 17:81228986-81229008 GTCCTCTGGGACGATGTTTGGGG + Exonic
1153682842 18:7516758-7516780 GAGCACTGAGAAGAGGGTTAAGG - Intergenic
1153806843 18:8716223-8716245 GACTACTGGGAAGTTGGTGAAGG + Intronic
1158241398 18:55382560-55382582 TTCCCCTTGGAAGATGGTTTTGG - Intronic
1159188346 18:65008693-65008715 GTCAACTGGGCAGTTGTTTAGGG + Intergenic
1161396416 19:4047155-4047177 GGCCACTGGGGAGATGGAGAGGG + Exonic
1162865512 19:13543196-13543218 ATTCCCTGGGAAGATGGATAGGG - Intronic
1166160821 19:40951523-40951545 GGCCAATGGGAAGCTGGTTCTGG + Intergenic
1167100076 19:47399272-47399294 GTACACTGGGAAGTTGGGGAGGG - Intergenic
1168476189 19:56677116-56677138 GTCCTCTGGGAGTATGTTTAAGG + Intergenic
925274818 2:2641280-2641302 GTCCACTGGAGGGATGGTGAGGG - Intergenic
928438024 2:31268517-31268539 GCCCACTGGGAAGCTGGTTGTGG - Exonic
932346515 2:70999338-70999360 CTTCCCTGGGAAGATGTTTAGGG - Intergenic
932361320 2:71109249-71109271 ATCCACTGCCAAGATGCTTATGG - Intergenic
935384003 2:102482426-102482448 GTCGTCTGGGGAGATGGATAAGG - Intronic
935432051 2:102986777-102986799 TTCCACTGGGAAGATGATCATGG + Intergenic
937036473 2:118786511-118786533 GTCCTCTGGGGAGATGCTCAGGG - Intergenic
938397993 2:130964525-130964547 GTCAACTGGGAAACTGATTAAGG + Intronic
938769781 2:134491344-134491366 GGCCACTGGGAAGATGGGGGTGG + Intronic
938784352 2:134611555-134611577 GTTCACTGGGAGGAGGGGTAGGG + Intronic
945411151 2:209509287-209509309 CTCCATGTGGAAGATGGTTAGGG - Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
947070693 2:226284759-226284781 GTGCCCTTGGAAGAGGGTTATGG - Intergenic
1169341281 20:4798258-4798280 ATCCTGGGGGAAGATGGTTATGG - Intronic
1170145466 20:13169175-13169197 TTCCACTGGGAAAATTGGTAGGG + Intergenic
1171767131 20:29296616-29296638 GTCCACCGGGGAGAGGGTTGGGG - Intergenic
1172830438 20:37829473-37829495 GGCCATTGGGATGATGGTGAGGG + Intronic
1173580003 20:44140439-44140461 GTCCTATGGGATGATGGTTTTGG + Intronic
1178837928 21:36113969-36113991 GTACACTTGGAAGAGGCTTAAGG - Intergenic
1178934833 21:36852410-36852432 GGCCCCTGGGAAGCTGGGTATGG - Intronic
1179082002 21:38179967-38179989 GTCCAAGGGGATGATGGTTTGGG + Intronic
1179321642 21:40297575-40297597 ATAGACTGAGAAGATGGTTAGGG + Intronic
1179679893 21:43011917-43011939 GGCCAATGGGAAGATGGATGTGG - Intronic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
952059714 3:29492699-29492721 GTCCAGTGGGAGGAAGGATATGG + Intronic
952091468 3:29891902-29891924 GTCCACAGGCAATATTGTTAGGG - Intronic
958450316 3:94265073-94265095 GACCACTGGGAAGTTAATTATGG + Intergenic
959160835 3:102722632-102722654 ATCCACTGGGAAGATGATGAGGG - Intergenic
960010092 3:112824407-112824429 GTCCAGTTGGAAGTTGGTTTTGG + Intronic
961484815 3:127209300-127209322 GCCCATGGGGAAGTTGGTTAAGG - Intergenic
971362091 4:25947511-25947533 GCCCACTGTGAGGCTGGTTAAGG + Intergenic
974845995 4:67351692-67351714 CTCCACTGGGGAGCTGCTTAGGG - Intergenic
979618852 4:122775787-122775809 GGCCTCAGGGAAGATGGTTGTGG + Intergenic
979763421 4:124435860-124435882 GTACACTGGGAAGCTGGTGAGGG - Intergenic
979787238 4:124731694-124731716 GTCCATTGGGAAAGTGATTACGG - Intergenic
980179219 4:129383636-129383658 GTCCACAGCGGAGATGGTCAAGG - Intergenic
981517627 4:145626885-145626907 GTCCCCTGGGAAGAAGTTTGAGG + Intronic
984421688 4:179531123-179531145 CTCCTCTGTGAAGCTGGTTATGG - Intergenic
985137486 4:186801787-186801809 GTCCAGAGGGAAGTTGGTGAGGG + Intergenic
985230301 4:187809179-187809201 GTCAACTGGAAACATGGTAATGG - Intergenic
988819194 5:34863765-34863787 CTCCACTGGAAAGATGTTAAGGG + Intronic
994851633 5:105061642-105061664 GTACACTGGGAAGACAGTTAAGG - Intergenic
997481042 5:134184745-134184767 GTCCTCTGGGCAGAGGGGTAGGG - Intronic
999681627 5:154065657-154065679 ATCTAAGGGGAAGATGGTTAGGG + Intronic
1001239186 5:170055399-170055421 GTCCACAGGGAAGAAGGATGGGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003334774 6:5160165-5160187 ATCCACTGGGAAGAAGGGAATGG - Intronic
1004133709 6:12946167-12946189 GTCCAGTGAGAAGGTGGGTAGGG + Intronic
1004890741 6:20098040-20098062 AACCACTGGGAAGAAGGTTATGG + Intergenic
1006353360 6:33538021-33538043 GTCCATGGGGATGATGGTGAAGG + Intergenic
1007763187 6:44146154-44146176 GTCTTCTGGGAACAGGGTTAAGG + Intronic
1007971240 6:46054298-46054320 GTGCTTTGGGAAGATGGTTTTGG - Intronic
1009716617 6:67405775-67405797 TTCAACTGGGAAGATTCTTAAGG + Intergenic
1012520839 6:100119417-100119439 GTCAACTGGGATGATGGCAAAGG - Intergenic
1012636181 6:101545185-101545207 TGCCACTGGGGAGATGCTTATGG + Intronic
1023973016 7:45005697-45005719 GCCCACTGAGAAGAGGGTTAGGG + Intronic
1024038934 7:45534306-45534328 GTCCAGTGGAAAGATGGGTGAGG + Intergenic
1027292088 7:76725272-76725294 GTCCAATGGGAAGATTTTTGAGG + Intergenic
1030116634 7:106066428-106066450 GTCCACTGTGAAAAAGCTTAAGG - Intergenic
1031369386 7:120946481-120946503 GTCTAATGGGAGGATAGTTAAGG - Intergenic
1031522788 7:122786888-122786910 TTCTAGTGGGAAGATGCTTAGGG - Intronic
1032682124 7:134195641-134195663 GTCAACTTGGAAGATGTTTGGGG - Intronic
1037651674 8:20844627-20844649 GGCCACCTGGAAGATGGTAAAGG + Intergenic
1038483042 8:27914817-27914839 TCCCACTGGGAAGATGCTTCTGG - Intronic
1041110513 8:54478316-54478338 GTGCACTGGCAAGATGACTAGGG + Intergenic
1041916729 8:63146100-63146122 GGTCACTGGGAAGATGGCGATGG + Intergenic
1045062846 8:98423940-98423962 GCCTGCTGGGAAGATGGTGAGGG - Intronic
1045493294 8:102686797-102686819 GTCCACTGGGAAAAGGTTTGTGG + Intergenic
1053138744 9:35668607-35668629 GTCTATTAGGCAGATGGTTATGG + Intronic
1056099582 9:83287857-83287879 GTCCACTGGGGAGATGGCAGTGG - Intronic
1056105144 9:83339742-83339764 TTCCTGTGGGAAGATGGATAAGG - Intronic
1056517003 9:87362553-87362575 GTCCACAGGGTAGATGCATAAGG - Intergenic
1057306337 9:93914316-93914338 TTCCTGTGGGAAGATGGGTAGGG - Intergenic
1057519551 9:95750695-95750717 GTCCATTTGGAAGATGGATATGG + Intergenic
1057726533 9:97572347-97572369 GTGCTCTGGGAAGATGGTTCTGG + Intronic
1059093665 9:111389315-111389337 GTCCACTGGGAAGATGGTTAAGG - Intronic
1061894732 9:133641330-133641352 GTCCACTGGGAAGCAGGGTAAGG - Intronic
1062712346 9:137983364-137983386 GTCCAGAGGGAAGGTGGTAAAGG + Intronic
1062721249 9:138045353-138045375 GGCCACTGAGTAGATGGTAAGGG + Intronic
1185945331 X:4369000-4369022 GGCAACTGGGAAAAAGGTTAAGG + Intergenic
1195476286 X:105289459-105289481 GTCCAGAGGGAAGATGATTATGG + Intronic
1201077978 Y:10200772-10200794 GTCCACTGGGGAGAGGGTGGGGG + Intergenic