ID: 1059094288

View in Genome Browser
Species Human (GRCh38)
Location 9:111395866-111395888
Sequence CTTTGAACACACATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059094288 Original CRISPR CTTTGAACACACATGAAGCA AGG (reversed) Intronic
900518985 1:3096597-3096619 CTTTCAACACACAGGCGGCAAGG - Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
903823575 1:26124145-26124167 CTCTGAACACATTTGAAACAGGG - Exonic
905031891 1:34889955-34889977 CTTTGGGCCCACATGAAGCGTGG + Intronic
906068456 1:42999653-42999675 CTTTGAAGACACAGGTAGTAGGG - Intergenic
909395621 1:75168160-75168182 CTTTGAAGGCTAATGAAGCAAGG - Intergenic
909962722 1:81866936-81866958 CTTTTAACAAACATTAAGCAAGG + Intronic
910536923 1:88309201-88309223 CTATGAATAAAAATGAAGCAGGG + Intergenic
911392591 1:97265418-97265440 CATTGAGCAGACAGGAAGCAGGG - Intronic
912500396 1:110118052-110118074 CCTTGAACACACATCAGGGATGG + Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915277312 1:154798228-154798250 GTTTGAACAAACAGGAAGAAAGG + Intronic
916836631 1:168552763-168552785 CTTTGGACACTCATGAAGCATGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918326439 1:183415600-183415622 TTATGAACACACATGGAGAATGG - Intronic
920794613 1:209126888-209126910 CTCTGAACACACAGGCACCAAGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064719121 10:18210410-18210432 CTTTGAACAAAGGTGAAGAATGG + Intronic
1068621876 10:59194576-59194598 CTTAGAAAACACATTAATCAGGG + Intronic
1068878594 10:62024589-62024611 CTTTGAACAGATAAGAAGCTAGG + Intronic
1069560881 10:69428454-69428476 GTTTGCACACACATGCATCAGGG - Intergenic
1073457223 10:103644950-103644972 TTTTGAATGCACATGCAGCAGGG + Intronic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074513501 10:114141499-114141521 CTCTCAACACACATCAGGCAGGG - Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076358722 10:129871341-129871363 CTTTGAGCTCACAAAAAGCAAGG - Intronic
1077639803 11:3871230-3871252 CTTTGAGCCCACATGAAGGTTGG - Intronic
1079405584 11:20142475-20142497 CTCTGAACAAATGTGAAGCAGGG + Intergenic
1083299665 11:61733813-61733835 CTTTGGACCCACATAAAGCCAGG + Intronic
1084573336 11:69973233-69973255 TTTTGAAGAAAAATGAAGCAGGG - Intergenic
1085344755 11:75761444-75761466 CTTTGAACAAACATAAAGGGAGG - Intronic
1085474353 11:76780603-76780625 CACTGAACAGACATGAAGAATGG + Intergenic
1085913289 11:80854044-80854066 CTTTGAACACATATGACACAAGG + Intergenic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088838395 11:113600012-113600034 CATTGAAAACAAATGAAGTAAGG + Intergenic
1089857044 11:121555033-121555055 CTTTCCAGACACATGAAGCCAGG - Intronic
1090775380 11:129960257-129960279 CTTTGGTCACACATAAAACATGG + Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1095857376 12:46874936-46874958 CTTTGGACAGCCAGGAAGCAGGG - Intergenic
1096875881 12:54630121-54630143 TCTTGCACACACATGAACCAGGG - Intergenic
1098616469 12:72530813-72530835 CTTTGAAAATAAATAAAGCAGGG - Intronic
1099849377 12:88073359-88073381 CTTTGAACTCACATTAATGAAGG + Intronic
1102308946 12:111828744-111828766 CATGGCACCCACATGAAGCAAGG + Intergenic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1107981844 13:45741469-45741491 CTTTAAACAGACATAAAGTAAGG + Intergenic
1109473512 13:62844456-62844478 ATATCAACTCACATGAAGCATGG + Intergenic
1110783328 13:79492270-79492292 CTTTGAACACTTATAAAGAAAGG - Intronic
1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG + Intergenic
1111728117 13:92038943-92038965 CTTTGAAGTCAAATGAAGAAAGG + Intronic
1111883331 13:93986407-93986429 ATCTGAACAAAGATGAAGCAGGG + Intronic
1113325619 13:109278325-109278347 CTATGAAGACAAATTAAGCAAGG - Intergenic
1113976826 13:114234043-114234065 ATTTAAACACCCATGAAGTATGG - Intergenic
1115871520 14:37809615-37809637 CTCAGACCACACATGTAGCAGGG + Intronic
1116184025 14:41573287-41573309 GATTGAACCCACATGAAGAAGGG - Intergenic
1117269232 14:54124615-54124637 CTTAGAATACACAAGAAGAAAGG + Intergenic
1117435659 14:55713166-55713188 CTTTAGACACACACAAAGCAAGG + Intergenic
1119275945 14:73356345-73356367 CTTTAAACACACTTAAAGCCAGG + Intronic
1119437900 14:74610236-74610258 CTATGAAGAAACATAAAGCAGGG + Intronic
1119975415 14:79019457-79019479 CTATGAAGACAAATAAAGCAGGG + Intronic
1122752576 14:103949313-103949335 CTATGAAAATCCATGAAGCAGGG + Intronic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1127712476 15:61613492-61613514 TTTAGAACATTCATGAAGCAGGG + Intergenic
1128794967 15:70459845-70459867 TTTTGCACATACAAGAAGCATGG + Intergenic
1131350285 15:91693273-91693295 CTTAGAACACACTTGTGGCAGGG - Intergenic
1131719435 15:95151444-95151466 CTCTGCACATACATGTAGCATGG + Intergenic
1131908526 15:97170697-97170719 CTTTGCACCCACAAGAAGCCTGG - Intergenic
1133484298 16:6203730-6203752 CTATGAACACACAAGAGACAAGG - Intronic
1138332842 16:56228839-56228861 CTTTTAAGATATATGAAGCAGGG - Intronic
1139117316 16:63972148-63972170 CTTTGAACAGACAGAGAGCATGG - Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1140545571 16:75805599-75805621 CTTAGAAAACATATCAAGCAAGG - Intergenic
1141823019 16:86460623-86460645 CTGGGAACACACCAGAAGCAAGG + Intergenic
1144209415 17:13002122-13002144 CTTTGAGCACAAAAGAAACACGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147417700 17:40305423-40305445 CTTTGAATATACATCAAGCCAGG + Intergenic
1150988743 17:70230376-70230398 CTTAGATAAAACATGAAGCAGGG - Intergenic
1152000012 17:77639359-77639381 ATTTGATCAGACATGAAGCCAGG + Intergenic
1156278490 18:35608400-35608422 CTTTTAAGATACAGGAAGCATGG - Intronic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1158234397 18:55296922-55296944 CATTGAACAAACACAAAGCATGG - Intronic
1158781120 18:60653175-60653197 CTTTGCAAAAACATCAAGCATGG - Intergenic
1159813272 18:73042582-73042604 ATGTGGACACACATGAGGCAGGG + Intergenic
1160287158 18:77554373-77554395 ATAGGAACACTCATGAAGCATGG - Intergenic
1162813828 19:13181247-13181269 CTTTGAACGCACATGCAGGACGG - Intergenic
1164519327 19:28966373-28966395 TTTTGAACTCAAATAAAGCAGGG - Intergenic
1168512840 19:56987283-56987305 ATTTGAACATAAATGAAGTAGGG + Intergenic
926658570 2:15438439-15438461 CTTTGAACAACAATGAAGTATGG + Intronic
928129109 2:28636663-28636685 CTTTAAACAAAAATCAAGCAGGG + Intronic
929316082 2:40480409-40480431 CTGTGTCCACACATGATGCAAGG - Intronic
931085060 2:58820732-58820754 CTTTGAATCCACACAAAGCATGG + Intergenic
931295834 2:60924199-60924221 CTATGGACATACATAAAGCAGGG - Exonic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933014051 2:77101914-77101936 TTTTGAAGACTCATGTAGCAAGG - Intronic
936807497 2:116354144-116354166 ATTTAAACACACATTAAGGATGG - Intergenic
936996921 2:118425260-118425282 TTTTTAAAACACATGAACCAAGG - Intergenic
937227855 2:120379867-120379889 ATATGAACACACATGCAACAGGG - Intergenic
943423547 2:187699424-187699446 CTTTGAACACACATGCTCCATGG - Intergenic
943853440 2:192757450-192757472 CTATGAACAAAATTGAAGCAGGG - Intergenic
944914779 2:204347323-204347345 CTTTGAACACTCCAGCAGCAAGG - Intergenic
946934581 2:224706971-224706993 CTTTGAAGACACATGACCAATGG + Intergenic
947374342 2:229480838-229480860 TTTTGAAAACACAGGAAACATGG + Intronic
948162019 2:235832899-235832921 TGTTGTACACTCATGAAGCAGGG - Intronic
1169762406 20:9110578-9110600 CTATGAAAATAAATGAAGCAAGG - Intronic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1172450829 20:35021427-35021449 CTCTGAACAGACTTGTAGCATGG + Intronic
1174358697 20:50014985-50015007 GTGTGAGCACACATGCAGCAGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175301164 20:57943640-57943662 CTTTGGCCCCACATGAAGCTAGG + Intergenic
1175390550 20:58624600-58624622 CTCTGAAAACACATGAAGCACGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177552684 21:22646269-22646291 CTTTGAACCTACATGAATAAAGG + Intergenic
1178150819 21:29791456-29791478 CTATCCACATACATGAAGCAGGG + Intronic
1178791444 21:35704090-35704112 CTTTGAACAGTCATGAAGTATGG - Intronic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1179988619 21:44934218-44934240 CTTGGAACACACAGGCAGCCAGG + Intronic
1180696638 22:17755344-17755366 ATGTGAACACACATGGACCATGG + Intronic
1183819490 22:40333832-40333854 ATTTGGGCACCCATGAAGCAGGG + Exonic
1185242505 22:49754250-49754272 CCTTGAAGACACATGGGGCAGGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
952329414 3:32350336-32350358 CTTAGAACACATATGAACAATGG - Intronic
953840604 3:46387300-46387322 CTTGGAAAACACATGACCCAGGG - Intergenic
956886982 3:73570036-73570058 CTTGGAAGAAAAATGAAGCAGGG - Intronic
958714022 3:97756571-97756593 CTTTGAAGACATATCTAGCATGG - Intergenic
959079107 3:101780923-101780945 CCTTGAAAAAAGATGAAGCAGGG - Intronic
960470560 3:118059809-118059831 ATTTGAACAAACATGAATCTAGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961799384 3:129433565-129433587 TTTTAAACACACATGAAAGAGGG + Intronic
963543413 3:146624184-146624206 TTTTGCTCACACATGAGGCATGG - Intergenic
964434242 3:156635290-156635312 CTATGAAGAAAAATGAAGCAGGG - Intergenic
964517630 3:157530157-157530179 CTCTGACCACACATGGAGAATGG + Intronic
965632696 3:170749545-170749567 CTTTAAACACACAAGATGCGAGG + Intronic
966675302 3:182579683-182579705 CCTGGACCACACATAAAGCAGGG - Intergenic
967094552 3:186166363-186166385 CTTTTCACAAACATGAAGAAAGG - Intronic
967626030 3:191684855-191684877 CTTTGAATTCACAGGAAACACGG - Intergenic
970068493 4:12127336-12127358 CTTTGGACACACAAGAATGAAGG + Intergenic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
972000367 4:34024294-34024316 TTTTGAACAGACATGAAGTAGGG + Intergenic
975311593 4:72909873-72909895 CTTTGTACAGTTATGAAGCAGGG - Intergenic
976757809 4:88516897-88516919 CTGTGAACAGATATGAAGCCAGG + Intergenic
977431139 4:96931319-96931341 CATTAATCACACATGAAACAAGG - Intergenic
978382303 4:108142146-108142168 CTTTGCAGACACCTGATGCAAGG + Intronic
980599124 4:134996948-134996970 TTTTGAAAACACCTGAAGAAGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
982108594 4:152032811-152032833 CTTTGAAGAGAAATAAAGCAGGG + Intergenic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
985306663 4:188549673-188549695 ATTTTATCACATATGAAGCACGG - Intergenic
986815112 5:11400665-11400687 CTAAGAAGATACATGAAGCAAGG + Intronic
988593859 5:32573117-32573139 CTTTGAACACACGCAAAGAAGGG + Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
993602659 5:89947564-89947586 CTATGAAAATACATAAAGCAGGG + Intergenic
995678253 5:114687452-114687474 CTTAGATCAAACCTGAAGCAGGG + Intergenic
995896676 5:117020642-117020664 CTTTGAACTCAAAGGAAGAATGG + Intergenic
997723263 5:136097946-136097968 CTGTGCTCACCCATGAAGCAGGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005108856 6:22255815-22255837 CTTTGAACACAAAAGTACCAGGG - Intergenic
1012021397 6:93925530-93925552 CTTTGCACTCACATGCACCAAGG - Intergenic
1012500356 6:99881367-99881389 ATTTGAACAAACATGGATCATGG - Intergenic
1012601860 6:101108576-101108598 CTATGAACACCAATGAAGAAGGG - Intergenic
1014145428 6:117992906-117992928 ATTTGACCAGAAATGAAGCATGG - Intronic
1014305936 6:119742327-119742349 TTTTGAACAGACATTAATCAAGG + Intergenic
1014732211 6:125046036-125046058 CTTTGAGGACACTTGAAGGAGGG + Intronic
1014910924 6:127092027-127092049 CTTTGTACACTCAGGAAACAAGG + Intergenic
1014976526 6:127891862-127891884 CCTTGAGCACATATAAAGCAGGG - Intronic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017000437 6:149992933-149992955 CATTGAATTCACATGAACCATGG - Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1022109260 7:27218278-27218300 CATAGAACACAAATGAAGGATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027651176 7:80870699-80870721 CATTGAACCAAAATGAAGCATGG + Intronic
1028120754 7:87054116-87054138 CATAGAACACACATGATGAAAGG + Intronic
1028533819 7:91868704-91868726 ATTTGAATAGACATAAAGCATGG + Intronic
1031567375 7:123317633-123317655 TTTTGAAGACACTTGAATCACGG + Intergenic
1032690333 7:134279728-134279750 CTCTGGAGACAAATGAAGCAGGG - Intergenic
1035778865 8:2211375-2211397 CTGTGAACACCCAGCAAGCAAGG - Intergenic
1038096761 8:24321352-24321374 CAATGAACGCACATGAAGCATGG + Intronic
1039287374 8:36056808-36056830 ATTTGGACAGACATGAAGCCAGG - Intergenic
1039717356 8:40124074-40124096 TTTTAAAAACATATGAAGCAAGG + Intergenic
1041668175 8:60466251-60466273 CTTTGAACAATAATGAAGTAGGG + Intergenic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1044513240 8:93108387-93108409 ATTTGAACACACAGGCAGTAGGG + Intergenic
1044559670 8:93600601-93600623 GTCTGAACATACATGAAGCTAGG - Intergenic
1045584945 8:103523694-103523716 TTTTGAACAAACATGAAGTTTGG + Intronic
1048363602 8:133718927-133718949 CTCTTAACACACATAAAGTAGGG + Intergenic
1048620484 8:136127570-136127592 CATTTAACACCCAAGAAGCAGGG - Intergenic
1048884738 8:138900896-138900918 ATTTGAACACAAAAAAAGCAGGG + Intronic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1052326032 9:27217540-27217562 ATTTGAAAACACATGTAGCTGGG + Intronic
1055001369 9:71453120-71453142 CATTTAACATACATGAAGAATGG + Intergenic
1055606334 9:77974632-77974654 CTTTCAACACCCAGGATGCAAGG + Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1056817022 9:89809372-89809394 CTTTGGAGAGACATTAAGCAAGG + Intergenic
1058745666 9:107988176-107988198 TATTGAGCACACATGTAGCATGG + Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1059861907 9:118473944-118473966 TTTTAAACACACATAAAGAAAGG + Intergenic
1060263655 9:122096413-122096435 CTAAGAACAGACATGAAGGAAGG - Intergenic
1062634519 9:137483415-137483437 ATTTTAAAACACATAAAGCATGG - Intronic
1189227609 X:39426586-39426608 CTTTGAGCACACAGGGAGCCAGG - Intergenic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1193647832 X:84089978-84090000 CTTTGAACATACATGAATATAGG + Intronic
1195759257 X:108228322-108228344 CCTTGAAAACAGATGATGCATGG + Intronic
1197004245 X:121476856-121476878 CTTTTAACAAACTTGAAGCAGGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic