ID: 1059096582

View in Genome Browser
Species Human (GRCh38)
Location 9:111422600-111422622
Sequence CTCTACAGTGAAAGGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059096582_1059096587 23 Left 1059096582 9:111422600-111422622 CCAAAGCTCCTTTCACTGTAGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1059096587 9:111422646-111422668 GGCCAACACAAAACCTGCACTGG No data
1059096582_1059096588 24 Left 1059096582 9:111422600-111422622 CCAAAGCTCCTTTCACTGTAGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1059096588 9:111422647-111422669 GCCAACACAAAACCTGCACTGGG No data
1059096582_1059096590 29 Left 1059096582 9:111422600-111422622 CCAAAGCTCCTTTCACTGTAGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1059096590 9:111422652-111422674 CACAAAACCTGCACTGGGCGTGG No data
1059096582_1059096585 2 Left 1059096582 9:111422600-111422622 CCAAAGCTCCTTTCACTGTAGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1059096585 9:111422625-111422647 GAGCAAGACCTGGTCTACACAGG No data
1059096582_1059096584 -8 Left 1059096582 9:111422600-111422622 CCAAAGCTCCTTTCACTGTAGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1059096584 9:111422615-111422637 CTGTAGAGAAGAGCAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059096582 Original CRISPR CTCTACAGTGAAAGGAGCTT TGG (reversed) Intronic
900537968 1:3188150-3188172 CTGTGCAGTGAAAGTAACTTTGG + Intronic
901876450 1:12169507-12169529 GGGTGCAGTGAAAGGAGCTTGGG - Intronic
902976757 1:20094125-20094147 CTCTACAGGGAAAGGAATTCTGG - Intergenic
903440631 1:23385448-23385470 CTCCACACGGAAAGGTGCTTGGG + Intronic
905529346 1:38664366-38664388 CTCCTCAGGGACAGGAGCTTTGG - Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
911368524 1:96969614-96969636 CTCTGCCGTGAAAGGTGTTTGGG + Intergenic
912699062 1:111862699-111862721 CTCTACAGAGAAGGGAACTGAGG - Intronic
915508602 1:156373119-156373141 CTCTCCAATCAAAGGTGCTTGGG + Intronic
916013591 1:160728450-160728472 ATGTAAAGTGAAAGGAGGTTGGG + Intergenic
917515371 1:175702694-175702716 CACTACAGTGACACGAGATTTGG + Intronic
917728182 1:177847562-177847584 CACAACAGTGACAGGAGCCTAGG + Intergenic
917860307 1:179137565-179137587 CTCAACAGTAAAAAGAACTTTGG + Intronic
920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG + Intergenic
1063536215 10:6886285-6886307 CTCACCAGTGACAGGATCTTAGG + Intergenic
1064029710 10:11876048-11876070 CCCCACAGTCAAAGGAGCCTGGG - Intergenic
1066486995 10:35855892-35855914 ATCTATATTGAAAGGAGTTTGGG - Intergenic
1067307936 10:45083169-45083191 CTCTATATTGAAAGGAGCTTGGG - Intergenic
1070388560 10:75949144-75949166 CTCTACAAAGAAAAGACCTTAGG + Intronic
1071481858 10:86070565-86070587 CTGTGGAGAGAAAGGAGCTTCGG - Intronic
1072027973 10:91482777-91482799 CTATACAGTGAAAAGAGCATGGG - Intronic
1073415919 10:103381976-103381998 CCCAACAGTGAAAAAAGCTTTGG + Intronic
1074092111 10:110270713-110270735 ATTTACAGTGAAAGGGGCCTAGG - Intronic
1074170197 10:110925819-110925841 CTCTGCAGGGAATGGAGTTTGGG - Intronic
1078540010 11:12205855-12205877 CCCTACAGAGAAAGCAGCTCTGG - Intronic
1078668170 11:13342783-13342805 CTGTACAGTGGAAGGAGTATGGG + Intronic
1080354742 11:31430064-31430086 CTCTACAGAGAAAGATTCTTTGG + Intronic
1080696151 11:34604585-34604607 CCCTTCAGTGAAAGGAGCATAGG - Intergenic
1081584133 11:44372519-44372541 GTCTACAGAGAGAAGAGCTTTGG - Intergenic
1082932694 11:58625189-58625211 CTCTAAAGTGAAAGGCACATAGG - Exonic
1083314343 11:61805013-61805035 CTCTTCAGTGACAGGTGCTTGGG + Intronic
1083705784 11:64513960-64513982 TTCTCCAGTGAAAGGAACTGGGG + Intergenic
1085114827 11:73921644-73921666 CTGGACAGTGAAAGGAGCACGGG - Intronic
1087638276 11:100727683-100727705 CTCCACAGGGACAGAAGCTTGGG + Intronic
1089011405 11:115135109-115135131 CTTTGCAGTTAAGGGAGCTTCGG - Intergenic
1089283172 11:117388605-117388627 TTTTACAGTGAAAGAAGCTAAGG - Intronic
1090879488 11:130821082-130821104 CTCAACAGTCAAAGGACCTACGG - Intergenic
1093346636 12:18044626-18044648 TTCTACAGATAAGGGAGCTTAGG + Intergenic
1093807700 12:23454931-23454953 CTATATAGTGATAGGAGCCTGGG - Intergenic
1095205942 12:39441257-39441279 CTCTACAGGCAAAGAAGCATCGG + Intronic
1100355378 12:93823920-93823942 GTCTACAGTTGAAGCAGCTTGGG + Intronic
1102481782 12:113228786-113228808 CACCACAGTGGAAGGCGCTTTGG + Intronic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1108160785 13:47636561-47636583 CTTATCAGTGAAAGGAGTTTTGG - Intergenic
1110007562 13:70292179-70292201 CTCTTCTGGGAAAGGAGTTTAGG - Intergenic
1110447918 13:75607897-75607919 TTCTACAGTGAAAAGGGCATGGG + Intergenic
1110764532 13:79267708-79267730 CTCTACAGTATAAGAAGCTGAGG - Intergenic
1111769409 13:92578107-92578129 CTCTACTGCAAAAGGAGCTAGGG - Intronic
1113108426 13:106796365-106796387 CTCTACAGTGAAATGAACAGAGG - Intergenic
1113508878 13:110835876-110835898 TTCTATAGTGAAAGGAACTGTGG + Intergenic
1114459839 14:22879282-22879304 GTCTGCAGTGAAAGGAGCTCGGG - Exonic
1115724258 14:36195372-36195394 CTCTGAAGTGAAAGGACCCTGGG - Intergenic
1116226264 14:42156194-42156216 CTCTAGAATGAAAGCTGCTTTGG + Intergenic
1117043559 14:51790197-51790219 CACTACAGTATAAGCAGCTTGGG - Intergenic
1117824139 14:59683518-59683540 TTCTACAGTGAATGGATCTTAGG - Intronic
1120222868 14:81754776-81754798 AGCTGCAGAGAAAGGAGCTTTGG + Intergenic
1121322396 14:92999593-92999615 CTCTACAGAGAAGGGAGCTGAGG - Intronic
1122729097 14:103781950-103781972 CTGTACAGTTAAAAGACCTTTGG - Intronic
1123806853 15:23882551-23882573 CTCTCCAGTAAAAGGAACTGAGG - Intergenic
1124851912 15:33347874-33347896 CTCTCCAATGAAAGGAACTAGGG - Intronic
1124926788 15:34077783-34077805 CTTTACAGTCCAAGGAGCTTAGG + Intergenic
1125605311 15:40936881-40936903 CCCCACAGTGACAAGAGCTTAGG + Exonic
1127607881 15:60608108-60608130 CTCTACAATGGCAGGAGCTGAGG + Intronic
1127638388 15:60892676-60892698 CTCTAGAGTGAAAGGAGTGAAGG - Intronic
1128801147 15:70497951-70497973 CTGTACAGGGAAGGGGGCTTTGG + Intergenic
1129914970 15:79260822-79260844 CTCTACTGGGCAAGGTGCTTGGG + Intergenic
1136871456 16:33811467-33811489 CTTTGCAGTGAGAGGAACTTGGG + Intergenic
1137555501 16:49467932-49467954 CTCTACAGTTAGAGGAACTGAGG - Intergenic
1140205747 16:72931678-72931700 CCCTACAGTGAAGGGAGATTGGG + Intronic
1140786493 16:78347279-78347301 ATCTACAGGGGAAGGAGCATTGG - Intronic
1141201704 16:81903342-81903364 CCAAACAGTGCAAGGAGCTTTGG + Intronic
1142247126 16:88975318-88975340 GTCTACCGTGGAAGGAGGTTAGG - Intronic
1203100716 16_KI270728v1_random:1304591-1304613 CTTTGCAGTGAGAGGAACTTGGG - Intergenic
1151009923 17:70482766-70482788 CACTACAGTGAACTGAGATTGGG + Intergenic
1151210419 17:72540278-72540300 CTCCCCAGTGAAAGAAGTTTGGG - Intergenic
1151537546 17:74747567-74747589 CGCCACAGGGAAAGGAGCCTTGG - Intergenic
1153047676 18:871584-871606 CTCGTCAGTGAATAGAGCTTAGG - Intergenic
1155683686 18:28520757-28520779 CTCTTCTGTCAATGGAGCTTAGG - Intergenic
1155855140 18:30824759-30824781 CATTACAGTGAAAGAAGCTTTGG + Intergenic
1156410015 18:36818773-36818795 CTCTACCTTGAAAGCAGCTGTGG + Intronic
1160656241 19:272125-272147 TTCTACAGTGAAAGGAACCAGGG + Intergenic
1162290413 19:9775976-9775998 CTATACAGAGATAGGAGCTGAGG + Intronic
1164083556 19:21881037-21881059 CTATACAGAGATAGGAGCTGAGG - Intergenic
1164084716 19:21890307-21890329 CTATACAGAGATAGGAGCTGAGG - Intergenic
1164897794 19:31892258-31892280 CTCAACAGGGAAATGAGCTCAGG - Intergenic
1166456276 19:42942673-42942695 CTATACAGAGATAGGAGCTGGGG - Intronic
925517529 2:4700073-4700095 CTCTACAGTAAAAGGTACTATGG + Intergenic
927454194 2:23235322-23235344 CTAAACAGTTAAAGGAGCTCTGG - Intergenic
930220117 2:48737871-48737893 CTTTACAGAGAAAGAATCTTAGG + Intronic
931716427 2:65032583-65032605 CACTACAGTGACAAGAGGTTTGG + Intergenic
932810671 2:74823097-74823119 CTGTAAAGTGACAGGAGATTAGG + Intergenic
934652189 2:96099056-96099078 CTCTCCAGGGACAGGAGCTGTGG + Intergenic
934945623 2:98539284-98539306 CTCTAAAGTGCAAGCAGCTGGGG - Intronic
935170316 2:100606496-100606518 CTCTGCAGAGAAAGGAGGCTGGG - Intergenic
935473418 2:103487732-103487754 ATCTACAGTGGAAGGAACTGAGG + Intergenic
936448900 2:112618700-112618722 CTCTACTGAGAATTGAGCTTTGG + Intergenic
938238023 2:129722298-129722320 CTATACAGTGAAATGAGCCAGGG + Intergenic
940975239 2:159935716-159935738 ATCTCCAGTCAAAGGAACTTAGG - Intronic
942267446 2:174242547-174242569 CTGTGAAGTGAAAGGAGCATGGG + Intronic
942471794 2:176268533-176268555 CTCATCAGTGAAGGGGGCTTTGG + Intergenic
942613094 2:177762308-177762330 CACTTCAGTGAGAGGGGCTTGGG - Intronic
947630972 2:231652813-231652835 CTCTGAAGTGAAAGGAGCTGGGG - Intergenic
948782105 2:240328174-240328196 TTCTCCTGTGAAAGCAGCTTTGG - Intergenic
1168980644 20:2000841-2000863 CTTTACAGTCAGAGGAACTTGGG - Intergenic
1169543594 20:6628284-6628306 CACAATAGTGAAAGGAACTTGGG + Intergenic
1170783930 20:19451270-19451292 CTCTTCAGTCAAAGGTCCTTGGG + Intronic
1172299773 20:33840996-33841018 CTCTGCAGTCAAACAAGCTTAGG - Intronic
1177486619 21:21766013-21766035 CTCTAAAGTTGAAGGAACTTTGG - Intergenic
1178629011 21:34243244-34243266 CTCACCAGTGAAATGAGCTGGGG + Intergenic
1179825182 21:43960652-43960674 GTCTCCAGTGACAGGTGCTTGGG - Intronic
1181278152 22:21699843-21699865 CTCAGCAGTGACAGCAGCTTAGG - Exonic
1182864095 22:33586825-33586847 CTCGACTGTGAAAGGAGCAGAGG - Intronic
1183807635 22:40225079-40225101 CACTACAATGGTAGGAGCTTGGG - Intronic
1183947538 22:41335176-41335198 CTCTGCAGTGGAACGTGCTTTGG + Intronic
1184248210 22:43246230-43246252 CTCCTCAGTGAAGGGTGCTTAGG + Intronic
951045790 3:18037077-18037099 CTCTACAGTGAAGACACCTTTGG + Intronic
952640554 3:35589240-35589262 CTCTACAGTCAAACAAACTTAGG + Intergenic
954142980 3:48619896-48619918 CTCCACAGTGATGGGGGCTTGGG + Intergenic
954940032 3:54363392-54363414 CTCTAGAGTGCAAGGAACTGGGG - Intronic
954973984 3:54675732-54675754 CTCAACAGTCAAAGAAGTTTCGG + Intronic
955616459 3:60812787-60812809 CTGTGCAGTGGAAGCAGCTTTGG + Intronic
960540193 3:118853598-118853620 CTCTATAGTGAAATCATCTTGGG + Intergenic
962712056 3:138095839-138095861 TTATACACTTAAAGGAGCTTTGG - Intronic
964338762 3:155685950-155685972 CTCTACAGGGAAATGAACCTGGG - Intronic
965803019 3:172513583-172513605 CTCTACTGTGAAAACAGCTCAGG + Intronic
966470570 3:180284254-180284276 CTGTAAAGTTAATGGAGCTTAGG + Intergenic
966812151 3:183856318-183856340 CCCTTCAGATAAAGGAGCTTTGG - Intronic
967771862 3:193342692-193342714 CGCTACAGTGAAAGGAGAGAGGG + Intronic
970657217 4:18244712-18244734 CTCTCCAGTGGAATGAGCTTGGG - Intergenic
971559357 4:28056002-28056024 CTTTTCAGAAAAAGGAGCTTAGG + Intergenic
972667456 4:41180848-41180870 CTATACAATGAAAACAGCTTTGG - Intronic
973027347 4:45289314-45289336 TTTATCAGTGAAAGGAGCTTTGG + Intergenic
974033353 4:56795933-56795955 GCCTGCAGGGAAAGGAGCTTTGG + Intergenic
974076408 4:57172388-57172410 CACTACAGACAAAGGAGCCTTGG - Intergenic
975134363 4:70860167-70860189 TTCTACTGTGAAAGGATATTCGG + Intergenic
977095715 4:92741187-92741209 TTTTACAGTGAAAGGAACTGAGG - Intronic
977561476 4:98537584-98537606 CTCTAAGGTGTAATGAGCTTAGG + Intronic
977682082 4:99807894-99807916 CGTTACAGTGAAGGCAGCTTGGG - Intergenic
978952090 4:114573021-114573043 ATCTCTAGTGAAAAGAGCTTTGG - Intergenic
982714156 4:158789239-158789261 CTCAGCTGTGAAAGTAGCTTGGG - Intronic
982766927 4:159359192-159359214 CATTGCAGTGAAAGCAGCTTGGG + Exonic
982971249 4:161990672-161990694 CTCTACAGTATAAGGATATTTGG + Intronic
985333251 4:188864369-188864391 CTCCACAGGGAAGGGAGATTGGG - Intergenic
985333273 4:188864451-188864473 CTCCACAGGGAAGGGAGATTGGG - Intergenic
986515591 5:8559810-8559832 CTCTAGAGTGAGTGGAGGTTGGG + Intergenic
988454732 5:31377454-31377476 CCCTACTGTGAAATGAACTTTGG + Intergenic
989075258 5:37558754-37558776 CTCTATAGGGAAAGCAGGTTGGG + Intronic
989453902 5:41619930-41619952 CTGTACAGTGAAGGGAGTATGGG - Intergenic
989678905 5:44006371-44006393 CTTTACAATGAACAGAGCTTTGG - Intergenic
993133634 5:83929813-83929835 CCCTACAGTGAAAGTGGCTGAGG + Intergenic
996500288 5:124209090-124209112 CTTTACAGTGAAAGAAACTGAGG - Intergenic
996958697 5:129217413-129217435 TACTACAGTGGAAGGAGTTTGGG - Intergenic
998445050 5:142191964-142191986 ATCTACAGTGGAAGGAATTTGGG + Intergenic
999441321 5:151603074-151603096 CTCTACTGTTAAAGGACATTTGG - Intergenic
1001050756 5:168412249-168412271 CTTTACACTAAAATGAGCTTCGG - Intronic
1001197053 5:169682832-169682854 ATCTACAGTGACAGGAAATTAGG - Intronic
1001393474 5:171399567-171399589 TTCTACAGAGAAACCAGCTTGGG + Intronic
1001459320 5:171895696-171895718 CGCTAGAGTGAAAGCAGCATGGG + Intronic
1004058849 6:12170751-12170773 CACTACAGGGAAAGGAGCACGGG + Intergenic
1004471718 6:15935307-15935329 CTGGACAGTGAAGGGAGCCTGGG + Intergenic
1007758680 6:44118527-44118549 CTCTCCTGTGAAATGAGCTTTGG - Intronic
1007863348 6:44938305-44938327 CTCTTCAGAAAAAGGAGCTGGGG - Intronic
1008138892 6:47809056-47809078 CTACACAGTGAAAAGAGTTTGGG + Intronic
1009552972 6:65123661-65123683 TTCAAAAGTGAAAGCAGCTTTGG + Intronic
1009858182 6:69291384-69291406 CACTAAGGTGAAAGGAGGTTTGG + Intronic
1013492480 6:110661910-110661932 CACTAATGTGAAAAGAGCTTTGG + Intronic
1014735386 6:125088993-125089015 CATTACAGTGAAAGGAGTTACGG - Exonic
1018527647 6:164730702-164730724 CTTTAGAGTGAAGGGAGGTTAGG + Intergenic
1019837230 7:3400176-3400198 GCCTACTGTGAATGGAGCTTAGG + Intronic
1019946073 7:4330472-4330494 CTCTTGAGTGCAAGGAGCTGGGG + Intergenic
1019951807 7:4379173-4379195 CTCTGCAGTGACATGAACTTTGG + Intergenic
1026480883 7:70778477-70778499 CTCTAGAGTGACTGGAACTTGGG - Intronic
1027269479 7:76512012-76512034 CTCTACAGTGGAAGGAGCCCGGG - Intronic
1027320189 7:77005906-77005928 CTCTACAGTGGAAGGAGCCCGGG - Intergenic
1029965597 7:104736430-104736452 CTCTACATTGAAAGAAACTCTGG - Intronic
1030998185 7:116383952-116383974 CTCTACAGTGAAAGGAATAAAGG + Intronic
1032358529 7:131232754-131232776 GCACACAGTGAAAGGAGCTTGGG + Intronic
1033152446 7:138927203-138927225 ATCTACAGTGGATGGAGATTTGG + Intronic
1038223193 8:25630288-25630310 TCCTACAGTGGAAGGAGCTTTGG + Intergenic
1038239561 8:25796173-25796195 CTCTACAGTGGAAAGAACATGGG + Intergenic
1038717828 8:30007851-30007873 CTCCACAGTGACAGGAGCCCAGG + Intergenic
1040004993 8:42612635-42612657 CTTAACTGTGCAAGGAGCTTTGG - Intergenic
1040494975 8:47958525-47958547 CTCTCAAGTGAAAGGAGATATGG + Intronic
1045594928 8:103643484-103643506 TTATTCAGTAAAAGGAGCTTAGG + Intronic
1047435304 8:124831037-124831059 CCCTACAATGAAAGAGGCTTAGG + Intergenic
1047492530 8:125386600-125386622 CTCTGCAGTGACAGGCGCTCAGG + Intergenic
1048661980 8:136614897-136614919 CTCCACAGTGAAAGAACTTTGGG - Intergenic
1052473603 9:28930584-28930606 TTCTGCCTTGAAAGGAGCTTAGG - Intergenic
1054776967 9:69132029-69132051 CTCTACTGGGAGAGGAGCCTTGG - Intronic
1054900261 9:70361317-70361339 TTCTACACTGAAAAGAGCATAGG + Intergenic
1055476197 9:76666053-76666075 CCATACAGTGATAGGAGCTGAGG + Intronic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1185952842 X:4455532-4455554 CACTACAGTGAAAACAGCATGGG - Intergenic
1190138463 X:47818871-47818893 CTATACAGTGAAAGAAGTTGTGG + Intergenic
1191791548 X:64976845-64976867 CCCTGCAGGGAAAGTAGCTTTGG + Intronic
1192136773 X:68609129-68609151 CTATACAGTCAAATGATCTTTGG + Intergenic
1192304739 X:69947110-69947132 TTCTAAAGTGAAAGGTGCTTTGG - Intronic
1193979765 X:88167958-88167980 CTCTACAGTCAGAAGAGATTGGG - Intergenic
1194842791 X:98764581-98764603 CTCTTCAATGAAAGGTACTTGGG + Intergenic
1195049040 X:101080156-101080178 GTCAAGAGAGAAAGGAGCTTAGG + Intronic
1195996773 X:110739545-110739567 CACTAGAGTGAAAGGGGCCTGGG + Intronic
1198812325 X:140548226-140548248 CTATGCAAAGAAAGGAGCTTAGG - Intergenic
1200329369 X:155280277-155280299 TTCTACAGATAAATGAGCTTTGG - Intronic
1201726943 Y:17163846-17163868 CTCTAAAGTGTAAGGAGTTTTGG - Intergenic
1201931923 Y:19360206-19360228 CTCAGCAGTGCAAGGAGCTGGGG + Intergenic