ID: 1059100956

View in Genome Browser
Species Human (GRCh38)
Location 9:111470881-111470903
Sequence GGCCTTGTGGACCTCAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059100956_1059100960 1 Left 1059100956 9:111470881-111470903 CCAACACTGAGGTCCACAAGGCC 0: 1
1: 0
2: 3
3: 16
4: 134
Right 1059100960 9:111470905-111470927 TTTCCCCCAGAGACAGCAGCTGG No data
1059100956_1059100965 25 Left 1059100956 9:111470881-111470903 CCAACACTGAGGTCCACAAGGCC 0: 1
1: 0
2: 3
3: 16
4: 134
Right 1059100965 9:111470929-111470951 AGAGATACTCAGTTAGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059100956 Original CRISPR GGCCTTGTGGACCTCAGTGT TGG (reversed) Intronic
905182141 1:36174030-36174052 GACCTTGTGTACCTCAGTGAGGG + Intronic
905199872 1:36308112-36308134 GACCCTGTAGACCTCAGGGTGGG - Exonic
905344264 1:37300758-37300780 AGCCTTGGGGATCTCAGAGTGGG + Intergenic
915570532 1:156743073-156743095 GGCATTCTGGACCTCTGGGTTGG - Intronic
922729918 1:227944548-227944570 GGCCTGGTGGGCCTCAGGGCTGG - Intronic
922801865 1:228368157-228368179 GGACTTGTGAACCTCAGTGGGGG - Intronic
923017120 1:230135589-230135611 TCCCTTGTGGAGCTGAGTGTGGG + Intronic
923345106 1:233043978-233044000 ACCCTTGTGGAAGTCAGTGTGGG - Intronic
1065947936 10:30624416-30624438 GACCTTTTGTACCTCAGTGCTGG + Intronic
1067965688 10:50910206-50910228 GGCCTTGAGGCCCACAGTGTGGG + Intergenic
1068817174 10:61330531-61330553 GGCTTTGGGGACATCGGTGTGGG - Intergenic
1069166772 10:65169735-65169757 GACTTTGGGCACCTCAGTGTTGG + Intergenic
1069626139 10:69868765-69868787 GGCCATGGGATCCTCAGTGTGGG - Intronic
1070270857 10:74953126-74953148 GGCCTTTTGGCTCTCAGTGGAGG + Intronic
1071700073 10:87922030-87922052 GGAGTTGTGATCCTCAGTGTTGG + Intronic
1072748564 10:97959509-97959531 GGCCTTGAGGCCCTGAGTTTTGG + Intronic
1074682248 10:115919082-115919104 GGAACTGTGGACCTCAGTGGTGG - Intronic
1076378780 10:130011111-130011133 GGCCTTGTGGAGCCAACTGTGGG - Intergenic
1076687115 10:132203160-132203182 GCCCAGTTGGACCTCAGTGTGGG + Intronic
1077296650 11:1829545-1829567 GGCCTTGGGGACCTCATGGCAGG - Intronic
1077353093 11:2101848-2101870 GTCCCAGTGGACGTCAGTGTGGG - Intergenic
1081453373 11:43195311-43195333 GGTCATGTGGACCTGTGTGTGGG - Intergenic
1084602222 11:70152648-70152670 GGCCTTGGGGAGCTCAGCGCAGG - Intronic
1085112498 11:73900324-73900346 GGCCTTGTGGTCCTGAGTGGGGG + Exonic
1092195861 12:6549395-6549417 GGCCTCCTGGCCCTCAGTTTGGG - Intronic
1100615265 12:96226515-96226537 GGACATGTGGACATCTGTGTGGG - Intronic
1102245148 12:111351161-111351183 GGCCTTGTGGGCATCTGGGTTGG + Intergenic
1102999943 12:117377608-117377630 GGCCTTGTACACCTCAGTGAGGG + Intronic
1103845778 12:123901183-123901205 GGCCTCAGGAACCTCAGTGTGGG - Intronic
1104075453 12:125385452-125385474 TGCCTTGTGGACCCTATTGTTGG + Intronic
1104411453 12:128561595-128561617 GACCGTGTGGACGTCATTGTTGG + Intronic
1104924215 12:132305723-132305745 GGCCTCCTGGAGCTCAGTTTGGG + Intronic
1106529712 13:30578200-30578222 GGCTTTATGAACCTTAGTGTAGG + Intronic
1108536598 13:51387497-51387519 GGCCTTTTGGATCTCAGCCTTGG - Exonic
1114274767 14:21132754-21132776 GGAATTGTAGACCCCAGTGTTGG - Intergenic
1115110157 14:29811676-29811698 GGGCTTGGGGTCCTCAGTGGTGG + Intronic
1115485946 14:33911464-33911486 GGCATTGAGGCCCTTAGTGTTGG + Intergenic
1116298034 14:43137294-43137316 GGCACTGTGGACGTCAGAGTAGG + Intergenic
1118039421 14:61900979-61901001 AGCCTTGTTGACTGCAGTGTAGG + Intergenic
1119010205 14:70977716-70977738 GGCCTCGTGAACCCCACTGTTGG - Exonic
1121444404 14:93969564-93969586 GGCCTTCTGGGCCTAAGTCTTGG + Intronic
1121668609 14:95691346-95691368 GGCCCTGTGCGTCTCAGTGTAGG + Intronic
1123054976 14:105565048-105565070 GCCCTTGTGGACCTGAGTGTGGG + Intergenic
1123079418 14:105684627-105684649 GCCCTTGTGGACCTGAGTGTGGG + Intergenic
1126593087 15:50359126-50359148 TGCCTTGTGGACCACACTTTTGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132939427 16:2499574-2499596 CCCCTTGTGGCCCTGAGTGTGGG - Intronic
1136160190 16:28414919-28414941 GGCCTCGCTGACCTCAGAGTTGG - Intergenic
1136202898 16:28700371-28700393 GGCCTCGCTGACCTCAGAGTTGG + Intronic
1142980140 17:3666848-3666870 GGCCTGGAGGAGCTCAGTTTGGG - Intronic
1144543137 17:16165636-16165658 TGACTTGTGTACCTCAGTTTTGG - Intronic
1147422174 17:40327307-40327329 GGCTTTCTGGGCCTCAGCGTGGG + Intronic
1149310229 17:55386164-55386186 GGAATTGTAGTCCTCAGTGTTGG + Intergenic
1151407857 17:73901085-73901107 GGCCTGGTGCACCTCAATGCTGG - Intergenic
1151457535 17:74235262-74235284 GGCCTTGCTGATCTCACTGTGGG + Intronic
1151530656 17:74702704-74702726 GTCCCCGTGGAGCTCAGTGTGGG - Intronic
1151948213 17:77330859-77330881 TGGCTTGTGGCCCTCAGTCTGGG + Intronic
1154145148 18:11860992-11861014 GCGCCTGTGAACCTCAGTGTGGG - Intronic
1157877609 18:51288100-51288122 GGGCTTCTGGACCTCAGGGCAGG - Intergenic
1158719757 18:59914320-59914342 AGCCATGAAGACCTCAGTGTTGG + Intergenic
1159002499 18:62986852-62986874 GGCCCTTTGGAGCTCAGGGTTGG - Intergenic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1160549475 18:79684360-79684382 AGCCTTGTGTAGCTTAGTGTCGG + Intronic
1160938674 19:1609915-1609937 GGCCTTGTGGACCCCTGGGCTGG - Exonic
1160966242 19:1748153-1748175 CGCCTCGTGGACCTCTGGGTGGG - Intergenic
1163740127 19:19006699-19006721 GGCCCTGTAGACCTCGGGGTCGG - Intronic
1164614058 19:29655544-29655566 GGACTTGGGGACATCAGTGAAGG + Intergenic
1164992155 19:32692274-32692296 GGTCTTGTGGTCATCGGTGTCGG - Exonic
1202647174 1_KI270706v1_random:153076-153098 GGCCTGGGGGCCCTCAGTCTTGG - Intergenic
926048376 2:9727036-9727058 GGCCTCGTGGAGCTCAGTTCTGG + Intergenic
929967661 2:46547727-46547749 AGCCTTCAGGACTTCAGTGTAGG + Intronic
931631403 2:64304379-64304401 GGTCTTGTGGACTTAAATGTAGG - Intergenic
939888430 2:147706796-147706818 GCCCTTGGGGAGCCCAGTGTAGG - Intergenic
945510114 2:210690813-210690835 GGCTGTGTGTTCCTCAGTGTAGG + Intergenic
948869794 2:240792166-240792188 GGCCTGGCGGACCTCAGGGCTGG - Intronic
948921233 2:241066859-241066881 GCCCTTGTGGGCCTCTGGGTGGG - Intronic
1168995913 20:2133154-2133176 GTCCATGTGGACCTCTCTGTGGG + Intronic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1173918662 20:46727817-46727839 TGCCTTGGGGACCACAGTGAAGG - Intronic
1176267180 20:64216076-64216098 GGCCTGGTGGTCCTCTGTGCTGG + Intronic
1178661948 21:34514276-34514298 GACCTCGTGGACCTCATTGTGGG + Intronic
1178824864 21:36006397-36006419 GGCCTTGTGGATCCCAGCCTGGG + Intergenic
1178841554 21:36141695-36141717 GGCCACCTGGACCTCAGTGGAGG + Intronic
1179170765 21:38971117-38971139 GTCCTTGTTAACCTGAGTGTTGG + Intergenic
1180714655 22:17863722-17863744 GGCCTTGTGGTGCTCATTCTGGG - Intronic
1181477762 22:23179483-23179505 AGCCCTGTGAACCTCAGTGCAGG + Intergenic
1182012591 22:27012756-27012778 GGAGCTGTGGACCTCAGTGGTGG + Intergenic
1182773702 22:32815266-32815288 GGCCTTGTGGGTCCCAGTGCAGG + Intronic
950567128 3:13776420-13776442 GGCATGGAGGAGCTCAGTGTTGG - Intergenic
950726761 3:14921962-14921984 GGCCTTGTAGTCCTCAGGGAGGG - Exonic
950858289 3:16125655-16125677 GGCCTTGTGGACATTTTTGTGGG - Intergenic
952369970 3:32712488-32712510 AGCATTTTGGACCTCAGGGTAGG - Intronic
953682571 3:45050974-45050996 GGACTTGTGGACCTCATTTTCGG - Intergenic
954129158 3:48551009-48551031 GTCCTTGTGGGCATCAGTCTGGG - Intronic
954610758 3:51943447-51943469 GGCCTTGAGGGCCTCAGCGGTGG - Exonic
956425542 3:69130634-69130656 ACCCTTGTGGAAGTCAGTGTGGG - Intergenic
956761210 3:72446923-72446945 GGACTTGTGGACTTGAGCGTGGG + Intergenic
957040992 3:75335470-75335492 TGCCTTGTGGACCTCTCCGTGGG - Intergenic
962407642 3:135113640-135113662 GGCCTTCTGGACTTCAGATTAGG + Intronic
966736391 3:183190314-183190336 GGCCATGAGGACCTCATTATTGG - Intronic
968972776 4:3804545-3804567 GGCCCTCTGGACCTCAGAATAGG + Intergenic
975640886 4:76499196-76499218 GGCCTTGTGGAAGTCTGTGTGGG + Intronic
981354331 4:143769844-143769866 GTTTTTGTGGACCTCAGTTTTGG - Intergenic
981929668 4:150175918-150175940 GCCCGTGTAGACCTCAGTGCAGG - Intronic
985547887 5:519192-519214 GGCCCTGTGGACCCCAGTCCTGG - Intronic
988320145 5:29684725-29684747 GGAGTTGTGATCCTCAGTGTTGG + Intergenic
988850410 5:35174829-35174851 GGCTTTGTGGTACTCAGGGTGGG - Intronic
989287606 5:39720853-39720875 GGCCTTTTGGATCTCAGCCTTGG - Intergenic
991415924 5:66392854-66392876 GGCCTTGTGGACCTCAACTTGGG + Intergenic
992384257 5:76268437-76268459 GGTCTTGTGGAACCCAGTGTGGG + Intronic
992842671 5:80711536-80711558 GGCCATGTGGACTTCAGTAGGGG + Intronic
992855970 5:80862113-80862135 AGCCTTGAGGAGCACAGTGTCGG + Intronic
997669068 5:135655594-135655616 GCCCTGGTGGTCTTCAGTGTGGG + Intergenic
998752276 5:145335843-145335865 ACCCTTGTGGAAGTCAGTGTGGG - Intergenic
999317133 5:150591311-150591333 GGCTCTGGGGACCTCAGTGATGG + Intergenic
999581517 5:153043668-153043690 CCCCTTGTGGACCCCATTGTTGG - Intergenic
1001866135 5:175107111-175107133 GGCCCTGTGGACATCACTATAGG - Intergenic
1002277865 5:178114844-178114866 GGCCTGGTGGACCGCAGTCTAGG + Intronic
1002761096 6:203091-203113 GGCTTTGTGGAGGTCAGTGGTGG - Intergenic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1007064183 6:38972775-38972797 GGCATTGTGGAACACAGAGTGGG + Intronic
1008194377 6:48500048-48500070 GGCTTCTTGGACCTCAGTCTAGG + Intergenic
1008971314 6:57372299-57372321 GGCCTAGTGGACCTTAGCATTGG + Intronic
1011648642 6:89484937-89484959 TGTCTTCTGGACCTCAGTGATGG + Intronic
1016626421 6:146174922-146174944 TGCCATGTGGACCTCTGTGTGGG + Intronic
1019313746 7:375242-375264 GGCCTCGCGGACCGCAGGGTTGG - Intergenic
1020607807 7:10360220-10360242 GGCCTGGTGCACTTCAGTGGGGG + Intergenic
1022594196 7:31696405-31696427 GGACTGTTGGAGCTCAGTGTGGG + Intronic
1025846103 7:65199275-65199297 GGACTTGTGGACCTAATTTTAGG - Intergenic
1025896323 7:65705002-65705024 GGACTTGTGGACCTAATTTTAGG - Intergenic
1030115650 7:106060376-106060398 GTCCTCCTGGAACTCAGTGTTGG - Intergenic
1031147511 7:118013606-118013628 GGCCATGTGCTGCTCAGTGTGGG + Intergenic
1032318946 7:130867375-130867397 GGACTTGTGGACATATGTGTTGG - Intergenic
1033249450 7:139746245-139746267 GGCCTTGTGCACCCCTGTGTGGG + Intronic
1035582496 8:748362-748384 GGCTCTGTGGACCTCAGTCTTGG - Intergenic
1037252636 8:16914791-16914813 GTCCTTGTGGACCTCAGGGTTGG - Intergenic
1040335912 8:46415872-46415894 GGCCATGGGGACTTCTGTGTTGG - Intergenic
1042725265 8:71868416-71868438 GGCATTGAGAACCTCAGTCTTGG - Intronic
1047221737 8:122924177-122924199 GGCCCTGTTGACCTCAGCGTTGG - Intronic
1049409458 8:142465986-142466008 GGCCCCGTGGGCCTCAGTGCAGG + Intronic
1050268746 9:3919040-3919062 GACCATGTGGGTCTCAGTGTAGG + Intronic
1052013677 9:23440987-23441009 GGTCATGTGGACCTCAGTTCTGG + Intergenic
1056478469 9:86976879-86976901 GGGCTTATAGACCTCAGAGTGGG + Intergenic
1057326966 9:94074509-94074531 GGCCCTGTGGTCCTCAGGGGAGG + Intronic
1059100956 9:111470881-111470903 GGCCTTGTGGACCTCAGTGTTGG - Intronic
1061523780 9:131140234-131140256 TGGCTTGTGTACCTCAGTGGAGG - Intronic
1062154216 9:135037394-135037416 GGCCATGTGGCTCTCTGTGTGGG - Intergenic
1185496294 X:556750-556772 GGCTGCTTGGACCTCAGTGTAGG + Intergenic
1193051102 X:77100650-77100672 ACCCTTGTGGAAGTCAGTGTGGG - Intergenic
1193203444 X:78719744-78719766 ACCCTTGTGGAAGTCAGTGTGGG + Intergenic
1195638035 X:107140395-107140417 GTCATTGTGTATCTCAGTGTAGG - Intronic
1196411319 X:115422595-115422617 GGCCTTGAGGAGTTCAGTGGAGG + Intergenic
1201777453 Y:17681843-17681865 GACATTTTGGACCTCATTGTGGG - Intergenic
1201824104 Y:18224149-18224171 GACATTTTGGACCTCATTGTGGG + Intergenic