ID: 1059102240

View in Genome Browser
Species Human (GRCh38)
Location 9:111483002-111483024
Sequence AATAGGCGGTGACCCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059102240_1059102241 -10 Left 1059102240 9:111483002-111483024 CCATCTGAGGGTCACCGCCTATT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1059102241 9:111483015-111483037 ACCGCCTATTCGTGACCTTTCGG No data
1059102240_1059102245 16 Left 1059102240 9:111483002-111483024 CCATCTGAGGGTCACCGCCTATT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1059102245 9:111483041-111483063 ATTACTAGAGTGTCACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059102240 Original CRISPR AATAGGCGGTGACCCTCAGA TGG (reversed) Intronic
904960372 1:34327947-34327969 ACTAGGCTGTGAGCCTCACAAGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
923092220 1:230749383-230749405 CGTGGGCGGTGCCCCTCAGAGGG - Intronic
1065134678 10:22656185-22656207 AACAGCCGGTGTCCCTCACACGG - Intronic
1070106997 10:73443532-73443554 AATAGACAATGACCCTTAGAGGG + Intronic
1076487369 10:130833181-130833203 AATGGGGAGTGACCCTCAGGTGG + Intergenic
1078849841 11:15153637-15153659 CATAGGGTGTGACCCTGAGAAGG + Intronic
1081695941 11:45109159-45109181 AATAGGAGGTGACCCAAAGAGGG - Intronic
1086372140 11:86165461-86165483 TATAGGAGGTGACCCAGAGAAGG - Intergenic
1091969326 12:4772586-4772608 AACAGCCAGTGATCCTCAGATGG + Exonic
1103925007 12:124418761-124418783 AGCAGTCAGTGACCCTCAGAGGG + Intronic
1103925586 12:124422024-124422046 AGCAGTCAGTGACCCTCAGAGGG + Intronic
1104428033 12:128694027-128694049 AATAAGAGGTGAGCCTCGGATGG + Exonic
1107010147 13:35662329-35662351 CAACGGCGGTGGCCCTCAGAGGG + Intronic
1112370400 13:98788391-98788413 AACAGCAGGTGACCCCCAGAGGG - Intergenic
1117488657 14:56224882-56224904 AATAGGAGGGGACCCAGAGAAGG - Intronic
1123133063 14:106002739-106002761 AATGGGCATTTACCCTCAGATGG - Intergenic
1123150058 14:106171948-106171970 AATGGGCATTTACCCTCAGATGG - Intergenic
1123196339 14:106619970-106619992 AATGGGCATTTACCCTCAGATGG - Intergenic
1123204232 14:106696300-106696322 AATGGGCATTTACCCTCAGATGG - Intergenic
1123583094 15:21733183-21733205 AATGGGCATTTACCCTCAGATGG - Intergenic
1123619744 15:22175780-22175802 AATGGGCATTTACCCTCAGATGG - Intergenic
1137340054 16:47592685-47592707 ATTAGGCTGTGAGCCTCTGAGGG + Intronic
1141516836 16:84550579-84550601 AATGGGAGATGACCCTCAGTGGG - Intronic
1146393546 17:32444272-32444294 AAGAGGCGGTGCCCCGCAGTGGG - Exonic
1157074446 18:44449843-44449865 AATAGGCGAATAGCCTCAGAAGG + Intergenic
1159902573 18:74061193-74061215 AATAGCCAGGGACCCTAAGAAGG - Intergenic
1159939201 18:74393548-74393570 CCTAGAGGGTGACCCTCAGATGG + Intergenic
1160558575 18:79741726-79741748 AAGAGGAGGTGAACCTCAGAAGG - Intronic
927967618 2:27281334-27281356 AGTAGGCTGTGACCCTGAGTGGG - Exonic
931744762 2:65282185-65282207 AATAGGCGGTGGGCCACAGAGGG - Intergenic
937037749 2:118795830-118795852 AATAGATGGTGAGCATCAGATGG - Intergenic
946180949 2:217948594-217948616 ACTAGGGGGTGATCCTGAGATGG - Intronic
947854118 2:233311708-233311730 AAGAGGTGGTGAACCTCAGATGG - Intronic
948962102 2:241347415-241347437 AGTAGGCGCTGGCCCTGAGATGG + Intronic
1170098502 20:12673038-12673060 AATAGCCAGTGCCCCTCTGAAGG + Intergenic
1175835694 20:61992988-61993010 AACAGGTTGTCACCCTCAGAGGG - Intronic
1178517317 21:33258817-33258839 AAGAGATGGGGACCCTCAGAGGG + Intronic
1180226685 21:46397683-46397705 CATGGGAGGTGGCCCTCAGAGGG - Intronic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
955380473 3:58434025-58434047 AGTAGGCGGTGACCGACAGGCGG + Intergenic
960355684 3:116650299-116650321 ACCAGGCGGAGACCCTCAGAAGG - Intronic
962185986 3:133259887-133259909 AATAGGCGGATGCCCACAGAAGG + Intronic
992268527 5:75041910-75041932 AATAGATTGTGACCCTCAAAAGG + Intergenic
994242112 5:97435759-97435781 AAAAGGCTGAGACCCACAGATGG - Intergenic
1000522013 5:162307079-162307101 AATATGCAGTGTCCCTCAAAAGG - Intergenic
1004021360 6:11778809-11778831 CTTAGGCTGTGACCCACAGAAGG - Intronic
1006170587 6:32089737-32089759 AATAGGGGGTGCCCATGAGAGGG - Intronic
1006322372 6:33327451-33327473 TATAGGCGGTGAGCCACAGCTGG - Intronic
1006457099 6:34138200-34138222 TATGGGAGCTGACCCTCAGAGGG - Intronic
1021422604 7:20462386-20462408 AATAGTCTGTGATCCTCAAAAGG + Intergenic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1026661573 7:72307502-72307524 AATGGGCTGTGATCCTCGGATGG + Intronic
1030861546 7:114637748-114637770 AAAATGGGGTGACCCTCAGAAGG + Intronic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1041163488 8:55069072-55069094 AGAAGGCGATGCCCCTCAGATGG - Intergenic
1043457589 8:80427816-80427838 GATGGGAGGTGACCCTCATAAGG + Intergenic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1061414243 9:130437630-130437652 CAGAGGCGGAGACCCACAGAGGG + Intergenic
1062216077 9:135390559-135390581 GAGAGGCGGTGACCCACGGAGGG + Intergenic
1062583616 9:137238958-137238980 CACAGGCCTTGACCCTCAGAGGG - Intergenic
1202584624 Y:26409696-26409718 CAGAGGCGGTGATCCCCAGAAGG + Intergenic