ID: 1059102451

View in Genome Browser
Species Human (GRCh38)
Location 9:111483701-111483723
Sequence GAAGGGCGACGCTCGCGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 21}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059102451_1059102454 3 Left 1059102451 9:111483701-111483723 CCGCGTCGCGAGCGTCGCCCTTC 0: 1
1: 0
2: 1
3: 0
4: 21
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102451_1059102456 4 Left 1059102451 9:111483701-111483723 CCGCGTCGCGAGCGTCGCCCTTC 0: 1
1: 0
2: 1
3: 0
4: 21
Right 1059102456 9:111483728-111483750 CCCCCGCGAGCTCGCGACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059102451 Original CRISPR GAAGGGCGACGCTCGCGACG CGG (reversed) Intronic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG + Exonic
1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG + Intronic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1142226759 16:88881336-88881358 GAAGGGCCCCGCTCCCGCCGCGG - Exonic
1167563950 19:50244413-50244435 GAAGGGGGATGCTCTCTACGTGG - Intronic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
941366908 2:164621192-164621214 GAGGGGCGACGCCCACGACCTGG - Exonic
948213851 2:236214589-236214611 GGAGGCGGACGCGCGCGACGAGG - Exonic
1184141815 22:42581969-42581991 GCAGGACGAAGCTCGCGGCGCGG - Intergenic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
1185281240 22:49970995-49971017 GAAGGGGGACGCTGGTGACAGGG + Intergenic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG + Intronic
991476663 5:67028552-67028574 GAAGGGAGACGCTCAGGAAGTGG + Intronic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG + Intronic
1035553198 8:545163-545185 GAAGGGCGAGGGTCTCGCCGGGG - Intronic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic