ID: 1059102451

View in Genome Browser
Species Human (GRCh38)
Location 9:111483701-111483723
Sequence GAAGGGCGACGCTCGCGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059102451_1059102456 4 Left 1059102451 9:111483701-111483723 CCGCGTCGCGAGCGTCGCCCTTC No data
Right 1059102456 9:111483728-111483750 CCCCCGCGAGCTCGCGACTCGGG No data
1059102451_1059102454 3 Left 1059102451 9:111483701-111483723 CCGCGTCGCGAGCGTCGCCCTTC No data
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059102451 Original CRISPR GAAGGGCGACGCTCGCGACG CGG (reversed) Intronic