ID: 1059102454

View in Genome Browser
Species Human (GRCh38)
Location 9:111483727-111483749
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059102446_1059102454 22 Left 1059102446 9:111483682-111483704 CCGCCGCCGCCTGCGTCCTCCGC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102450_1059102454 6 Left 1059102450 9:111483698-111483720 CCTCCGCGTCGCGAGCGTCGCCC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102445_1059102454 25 Left 1059102445 9:111483679-111483701 CCGCCGCCGCCGCCTGCGTCCTC 0: 1
1: 1
2: 12
3: 144
4: 1004
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102442_1059102454 30 Left 1059102442 9:111483674-111483696 CCCGCCCGCCGCCGCCGCCTGCG 0: 1
1: 1
2: 55
3: 240
4: 1297
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102447_1059102454 19 Left 1059102447 9:111483685-111483707 CCGCCGCCTGCGTCCTCCGCGTC 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102443_1059102454 29 Left 1059102443 9:111483675-111483697 CCGCCCGCCGCCGCCGCCTGCGT 0: 1
1: 0
2: 13
3: 174
4: 2117
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102448_1059102454 16 Left 1059102448 9:111483688-111483710 CCGCCTGCGTCCTCCGCGTCGCG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102449_1059102454 13 Left 1059102449 9:111483691-111483713 CCTGCGTCCTCCGCGTCGCGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102444_1059102454 26 Left 1059102444 9:111483678-111483700 CCCGCCGCCGCCGCCTGCGTCCT 0: 1
1: 0
2: 7
3: 56
4: 445
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data
1059102451_1059102454 3 Left 1059102451 9:111483701-111483723 CCGCGTCGCGAGCGTCGCCCTTC 0: 1
1: 0
2: 1
3: 0
4: 21
Right 1059102454 9:111483727-111483749 GCCCCCGCGAGCTCGCGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr