ID: 1059102543

View in Genome Browser
Species Human (GRCh38)
Location 9:111484079-111484101
Sequence GGGCCAGTCCCCCGCGGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059102535_1059102543 1 Left 1059102535 9:111484055-111484077 CCTAACCGCGCCGCCGCGCGCGC 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234
1059102539_1059102543 -9 Left 1059102539 9:111484065-111484087 CCGCCGCGCGCGCAGGGCCAGTC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234
1059102538_1059102543 -4 Left 1059102538 9:111484060-111484082 CCGCGCCGCCGCGCGCGCAGGGC 0: 1
1: 1
2: 1
3: 19
4: 276
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234
1059102533_1059102543 6 Left 1059102533 9:111484050-111484072 CCCGGCCTAACCGCGCCGCCGCG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234
1059102534_1059102543 5 Left 1059102534 9:111484051-111484073 CCGGCCTAACCGCGCCGCCGCGC 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234
1059102532_1059102543 19 Left 1059102532 9:111484037-111484059 CCTGTGCGGGCGGCCCGGCCTAA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 35
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059102543 Original CRISPR GGGCCAGTCCCCCGCGGCCC GGG Exonic