ID: 1059107126

View in Genome Browser
Species Human (GRCh38)
Location 9:111521528-111521550
Sequence ACTGACTGGCTCTGAGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107126_1059107129 5 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107129 9:111521556-111521578 ATCTACCAGTTGAGTGACCTTGG No data
1059107126_1059107130 6 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107130 9:111521557-111521579 TCTACCAGTTGAGTGACCTTGGG No data
1059107126_1059107133 26 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107126_1059107134 27 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107126 Original CRISPR ACTGACTGGCTCTGAGCCCA AGG (reversed) Intergenic