ID: 1059107127

View in Genome Browser
Species Human (GRCh38)
Location 9:111521542-111521564
Sequence CTGGTAGATTGGAAACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107127_1059107129 -9 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107129 9:111521556-111521578 ATCTACCAGTTGAGTGACCTTGG No data
1059107127_1059107134 13 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107127_1059107133 12 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107127_1059107130 -8 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107130 9:111521557-111521579 TCTACCAGTTGAGTGACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107127 Original CRISPR CTGGTAGATTGGAAACTGAC TGG (reversed) Intergenic