ID: 1059107128

View in Genome Browser
Species Human (GRCh38)
Location 9:111521553-111521575
Sequence AGGTCACTCAACTGGTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107128_1059107134 2 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107128_1059107142 30 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107128_1059107140 23 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107140 9:111521599-111521621 GGTCTCATTTTTGAAAAAATAGG No data
1059107128_1059107141 29 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107141 9:111521605-111521627 ATTTTTGAAAAAATAGGATATGG No data
1059107128_1059107133 1 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107128 Original CRISPR AGGTCACTCAACTGGTAGAT TGG (reversed) Intergenic