ID: 1059107131

View in Genome Browser
Species Human (GRCh38)
Location 9:111521561-111521583
Sequence CTTGCCCAAGGTCACTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107131_1059107141 21 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107141 9:111521605-111521627 ATTTTTGAAAAAATAGGATATGG No data
1059107131_1059107145 27 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107145 9:111521611-111521633 GAAAAAATAGGATATGGGGAGGG No data
1059107131_1059107142 22 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107131_1059107140 15 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107140 9:111521599-111521621 GGTCTCATTTTTGAAAAAATAGG No data
1059107131_1059107143 23 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107143 9:111521607-111521629 TTTTGAAAAAATAGGATATGGGG No data
1059107131_1059107144 26 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107144 9:111521610-111521632 TGAAAAAATAGGATATGGGGAGG No data
1059107131_1059107133 -7 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107131_1059107134 -6 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107131_1059107146 28 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107146 9:111521612-111521634 AAAAAATAGGATATGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107131 Original CRISPR CTTGCCCAAGGTCACTCAAC TGG (reversed) Intergenic