ID: 1059107132

View in Genome Browser
Species Human (GRCh38)
Location 9:111521573-111521595
Sequence CGCAGGGAGGGGCTTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107132_1059107149 24 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107149 9:111521620-111521642 GGATATGGGGAGGGGTGGGCAGG No data
1059107132_1059107142 10 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107132_1059107144 14 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107144 9:111521610-111521632 TGAAAAAATAGGATATGGGGAGG No data
1059107132_1059107140 3 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107140 9:111521599-111521621 GGTCTCATTTTTGAAAAAATAGG No data
1059107132_1059107145 15 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107145 9:111521611-111521633 GAAAAAATAGGATATGGGGAGGG No data
1059107132_1059107141 9 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107141 9:111521605-111521627 ATTTTTGAAAAAATAGGATATGG No data
1059107132_1059107147 19 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107147 9:111521615-111521637 AAATAGGATATGGGGAGGGGTGG No data
1059107132_1059107148 20 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107148 9:111521616-111521638 AATAGGATATGGGGAGGGGTGGG No data
1059107132_1059107143 11 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107143 9:111521607-111521629 TTTTGAAAAAATAGGATATGGGG No data
1059107132_1059107146 16 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107146 9:111521612-111521634 AAAAAATAGGATATGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107132 Original CRISPR CGCAGGGAGGGGCTTGCCCA AGG (reversed) Intergenic