ID: 1059107133

View in Genome Browser
Species Human (GRCh38)
Location 9:111521577-111521599
Sequence GGGCAAGCCCCTCCCTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107126_1059107133 26 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107128_1059107133 1 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107127_1059107133 12 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data
1059107131_1059107133 -7 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107133 Original CRISPR GGGCAAGCCCCTCCCTGCGC TGG Intergenic