ID: 1059107134

View in Genome Browser
Species Human (GRCh38)
Location 9:111521578-111521600
Sequence GGCAAGCCCCTCCCTGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107126_1059107134 27 Left 1059107126 9:111521528-111521550 CCTTGGGCTCAGAGCCAGTCAGT No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107127_1059107134 13 Left 1059107127 9:111521542-111521564 CCAGTCAGTTTCCAATCTACCAG No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107128_1059107134 2 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data
1059107131_1059107134 -6 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107134 9:111521578-111521600 GGCAAGCCCCTCCCTGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107134 Original CRISPR GGCAAGCCCCTCCCTGCGCT GGG Intergenic