ID: 1059107136

View in Genome Browser
Species Human (GRCh38)
Location 9:111521585-111521607
Sequence AATGAGACCCAGCGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107136_1059107142 -2 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107136_1059107148 8 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107148 9:111521616-111521638 AATAGGATATGGGGAGGGGTGGG No data
1059107136_1059107150 19 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107150 9:111521627-111521649 GGGAGGGGTGGGCAGGACCTTGG No data
1059107136_1059107140 -9 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107140 9:111521599-111521621 GGTCTCATTTTTGAAAAAATAGG No data
1059107136_1059107143 -1 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107143 9:111521607-111521629 TTTTGAAAAAATAGGATATGGGG No data
1059107136_1059107144 2 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107144 9:111521610-111521632 TGAAAAAATAGGATATGGGGAGG No data
1059107136_1059107147 7 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107147 9:111521615-111521637 AAATAGGATATGGGGAGGGGTGG No data
1059107136_1059107145 3 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107145 9:111521611-111521633 GAAAAAATAGGATATGGGGAGGG No data
1059107136_1059107141 -3 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107141 9:111521605-111521627 ATTTTTGAAAAAATAGGATATGG No data
1059107136_1059107146 4 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107146 9:111521612-111521634 AAAAAATAGGATATGGGGAGGGG No data
1059107136_1059107149 12 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107149 9:111521620-111521642 GGATATGGGGAGGGGTGGGCAGG No data
1059107136_1059107151 20 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107151 9:111521628-111521650 GGAGGGGTGGGCAGGACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107136 Original CRISPR AATGAGACCCAGCGCAGGGA GGG (reversed) Intergenic