ID: 1059107142

View in Genome Browser
Species Human (GRCh38)
Location 9:111521606-111521628
Sequence TTTTTGAAAAAATAGGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059107138_1059107142 -6 Left 1059107138 9:111521589-111521611 CCCTGCGCTGGGTCTCATTTTTG No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107135_1059107142 -1 Left 1059107135 9:111521584-111521606 CCCCTCCCTGCGCTGGGTCTCAT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107139_1059107142 -7 Left 1059107139 9:111521590-111521612 CCTGCGCTGGGTCTCATTTTTGA No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107131_1059107142 22 Left 1059107131 9:111521561-111521583 CCAGTTGAGTGACCTTGGGCAAG No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107137_1059107142 -3 Left 1059107137 9:111521586-111521608 CCTCCCTGCGCTGGGTCTCATTT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107128_1059107142 30 Left 1059107128 9:111521553-111521575 CCAATCTACCAGTTGAGTGACCT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107136_1059107142 -2 Left 1059107136 9:111521585-111521607 CCCTCCCTGCGCTGGGTCTCATT No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data
1059107132_1059107142 10 Left 1059107132 9:111521573-111521595 CCTTGGGCAAGCCCCTCCCTGCG No data
Right 1059107142 9:111521606-111521628 TTTTTGAAAAAATAGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059107142 Original CRISPR TTTTTGAAAAAATAGGATAT GGG Intergenic