ID: 1059112961

View in Genome Browser
Species Human (GRCh38)
Location 9:111574058-111574080
Sequence TGTGACTTGCTGTGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059112961_1059112968 22 Left 1059112961 9:111574058-111574080 CCCTTCACCCACAGCAAGTCACA 0: 1
1: 0
2: 2
3: 24
4: 289
Right 1059112968 9:111574103-111574125 GCAATGTCTCTAATATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059112961 Original CRISPR TGTGACTTGCTGTGGGTGAA GGG (reversed) Intronic
900463494 1:2812543-2812565 TGTGACCTCCTGTGGCTCAAGGG + Intergenic
900873538 1:5324495-5324517 TGTGCCTTGGAGTGTGTGAAGGG - Intergenic
901752123 1:11416739-11416761 TGTGAGTTGCTGCGGCTGACGGG - Intergenic
903035218 1:20488475-20488497 TCTCACTTGCTGTGTGTGCAGGG - Intergenic
903043895 1:20552209-20552231 AATGACATGCTGTGGGTGAGGGG + Intergenic
903499291 1:23792771-23792793 AGTGTCTGGCCGTGGGTGAAAGG - Intronic
905173788 1:36124433-36124455 TGAGACTTGCAGGGGGTGAGGGG - Intronic
906463605 1:46056919-46056941 TGTCACTTGCTGTGGGGCCATGG + Intronic
907421171 1:54348386-54348408 TGTGACTGGCTGAGGGGGCAAGG - Intronic
907903018 1:58758979-58759001 TCAGACTTGCTGTGGGTATAAGG + Intergenic
908235887 1:62147052-62147074 TGTGACATCCAGTGGGTGACTGG + Intronic
911175904 1:94818322-94818344 TGTCAGGTGCTGGGGGTGAAGGG - Intergenic
912219759 1:107659968-107659990 TGTGTCTTGAGGTGGGGGAAAGG - Intronic
912868837 1:113284804-113284826 TATGACTTGCTTTGGCTGATGGG - Intergenic
913205935 1:116538766-116538788 TGTCATGTGCTGTGGTTGAAAGG - Intronic
914352192 1:146850071-146850093 TGTGTCTGAATGTGGGTGAAGGG - Intergenic
916063237 1:161116548-161116570 TCTGACTTGGGGTGGGGGAAGGG - Intronic
916925049 1:169510344-169510366 TCTGACTTGCTTAGGGTGATAGG - Intergenic
918462400 1:184789942-184789964 TGTTACTGGCTGTGGGGGCAGGG + Intergenic
920723672 1:208413674-208413696 TATGATTTCCTGTGGGTGAGTGG + Intergenic
921742809 1:218705937-218705959 TGTGACTTGGTGTGTGTCATGGG + Intergenic
922570671 1:226633144-226633166 TGACACTTGCTGGGGGTGGAGGG - Exonic
922818438 1:228467964-228467986 TGTGTCTGGCTGTGGGGAAAAGG + Intergenic
923232671 1:232002476-232002498 GATGTCTTTCTGTGGGTGAATGG + Intronic
923291474 1:232550331-232550353 TCTGACTTGCGGTGGGTGGCTGG - Intronic
923740324 1:236648549-236648571 TGTGACTTGGTATTGGTAAAAGG + Intergenic
1062970881 10:1648294-1648316 TGTGCCTGGTTGTGTGTGAAAGG - Intronic
1063974610 10:11405324-11405346 TGTGCCTTGGTGTGGATGCAGGG - Intergenic
1064327782 10:14366712-14366734 TGTGACTTGCTTGGGTTGATAGG + Intronic
1064441144 10:15354616-15354638 TGTGAAGTGCTGTTGGAGAAAGG - Intronic
1065190974 10:23208769-23208791 TGTGACTTGCTTTGGCTAATGGG + Intronic
1066166705 10:32796259-32796281 TATGGCTTTCTGTGGGGGAAAGG + Intronic
1067541920 10:47160975-47160997 TGTGACTTGCTTTGGCTAATGGG + Intergenic
1068006486 10:51397510-51397532 TTTGACTTGCTGTGGTTTAGAGG + Intronic
1068039651 10:51807829-51807851 TATGACTTGCTTTGGGGAAAAGG + Intronic
1068829974 10:61482848-61482870 TAGGACTTGCTGTGGGGGAGAGG - Intergenic
1069031831 10:63604595-63604617 TATGACTTTCTGTTTGTGAATGG + Intronic
1070553429 10:77509862-77509884 TGTGCCTTGCTGAGGGTGGGAGG - Intronic
1070606359 10:77901180-77901202 TGTGCCTTGCTGTGGGCGCTTGG - Intronic
1073028760 10:100508127-100508149 TTGGACTTGCTGTGGGTGGCTGG - Intronic
1073553220 10:104422797-104422819 TGTGACTTGCTTTGGCTAATGGG - Intronic
1074360190 10:112819659-112819681 TGTGACTTGCTATTGGTGAATGG + Intergenic
1074773139 10:116746135-116746157 TGTGTGGGGCTGTGGGTGAACGG - Intergenic
1075558842 10:123453498-123453520 TGTTACTTGCTGTGTCTGGAAGG + Intergenic
1075594454 10:123718145-123718167 TGTGCCAGGCAGTGGGTGAAAGG + Intronic
1075966366 10:126615212-126615234 TGTGACTTGCTTTAGGCAAAAGG - Intronic
1078384335 11:10874612-10874634 TGAGACTTGGGGTGGGGGAAGGG - Intergenic
1078501275 11:11880339-11880361 TTTGACTTGGTGTGGGGAAATGG + Exonic
1078522577 11:12075208-12075230 TGTGACTTGCTGTGGACAATAGG - Intergenic
1080144679 11:28967371-28967393 TGTGACTTGCTTTGGCTAATGGG - Intergenic
1080183681 11:29453699-29453721 TTTAACTTTCTGTGGGTGGATGG + Intergenic
1080388311 11:31823232-31823254 TCTCACTTGCTCTAGGTGAATGG - Intronic
1080575762 11:33597742-33597764 TGTGACTTGCCCTGTGTGAAGGG + Intronic
1082059878 11:47850770-47850792 TGAGTTTTGCTGTGGGTGAGAGG - Intergenic
1083371000 11:62180910-62180932 TGTAAATTGCTTTGGGTGTATGG + Intergenic
1083527109 11:63378934-63378956 TGTAAATTGCTTTGGGTGTATGG - Intronic
1083651655 11:64207938-64207960 TGTAACTTCCTGTGGGGGCAGGG - Intronic
1084001886 11:66300240-66300262 TGTGATTTGCTGTGACTGATTGG + Intergenic
1085031420 11:73273125-73273147 TGTGACTTGTTAAGGGTGAAAGG + Intronic
1085212078 11:74790673-74790695 TGTGCCTTGCTGTGGCTGGGTGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088979593 11:114850171-114850193 TTTGACTTGCTTTGGCTGCATGG - Intergenic
1089271432 11:117304116-117304138 TGTGACTGGCTGTGGGCAACAGG + Intronic
1089709082 11:120302146-120302168 TGGGACTTGAGGTGGGTGGAGGG + Intronic
1091271346 11:134313788-134313810 TCTGACCTGCTGTGACTGAAGGG - Intronic
1091615990 12:2052072-2052094 TGGAACTTGCTGTGGTTGCAGGG + Intronic
1093410097 12:18854653-18854675 TGTGACTTGCTTTGGCAGATGGG - Intergenic
1093994949 12:25631122-25631144 TGGGTCTTGCTGTGGGGGATGGG - Intronic
1094229791 12:28090025-28090047 TGTCACTTGCTTTGAGTGACTGG + Intergenic
1094529520 12:31260748-31260770 TGTGACTTGCTTTGGATAATGGG + Intergenic
1094769629 12:33639164-33639186 TATGACTTGCTTTGGGGGAGAGG - Intergenic
1094811501 12:34142899-34142921 TGTGACGTGCTGTGGGAGTGGGG - Intergenic
1097208117 12:57341348-57341370 TGTGACTTGATGTTGGTAACTGG - Intronic
1097277262 12:57822018-57822040 TGTGAATTGCTTTAGGTGCAGGG - Exonic
1098966023 12:76789539-76789561 AGTGACTAACTGTGGTTGAAAGG + Intronic
1100208694 12:92378767-92378789 TGTGATGTGCTGTGGATGATGGG - Intergenic
1100504912 12:95209955-95209977 TGTCGCTTGCTGTGGACGAAGGG - Exonic
1100909852 12:99346844-99346866 TTTGACTGGCAGTAGGTGAAGGG - Intronic
1101158321 12:101948660-101948682 TGTGACTTACTTTGGCTGATGGG - Intronic
1101415910 12:104507861-104507883 TGTGACTTGCTGTGGCCAATGGG - Intronic
1103082687 12:118037769-118037791 AGTCACTTGCTGTGACTGAAGGG - Intronic
1103852590 12:123943008-123943030 TGGGATATGCTGTGGGGGAATGG - Intronic
1104186129 12:126433586-126433608 TGTGCCTTTCAGAGGGTGAAGGG - Intergenic
1105552847 13:21414143-21414165 ATTTACTTGCTTTGGGTGAAAGG + Intronic
1105824287 13:24108428-24108450 TGTGACTCACTGTGGGTGCGTGG + Intronic
1106488993 13:30199668-30199690 AGTGACTTGCTCTAGTTGAACGG - Intergenic
1106965480 13:35060831-35060853 AGTCACTTTCTGTGAGTGAAGGG + Intronic
1108020697 13:46125070-46125092 TATGGCTTGCTTTGGGGGAAAGG - Intergenic
1108345850 13:49546344-49546366 TTTGACTTTCAGTGGGTGGAAGG + Intronic
1109009140 13:56917479-56917501 TGTGGCTTGCGTTGGGGGAAAGG - Intergenic
1109943876 13:69406691-69406713 TCTGACTTGCAGTGGGTCCAGGG - Intergenic
1112255304 13:97825222-97825244 TGTGACTTGCTTTGGCTAATGGG + Intergenic
1112818979 13:103308883-103308905 TGTGAACAGCTGGGGGTGAACGG + Intergenic
1113532558 13:111039186-111039208 TGTGGCTCCCTGTGGGTAAACGG - Intergenic
1113571687 13:111362437-111362459 TGTGAGTGGCTGGGGCTGAAGGG + Intergenic
1114168459 14:20246434-20246456 TGTGTCTTTATGTGGTTGAAGGG - Intergenic
1114454857 14:22847786-22847808 GGTGACGGGCTGTGGGTGAGAGG + Intronic
1114585970 14:23813960-23813982 ACTGCCTTGCTGTGGGTGAATGG - Intergenic
1116789298 14:49322897-49322919 TGTGAGCTCCTGTGGGTTAAGGG - Intergenic
1119896904 14:78227984-78228006 TGTGACTTGCTTTCGCTGAATGG - Intergenic
1120073582 14:80130726-80130748 TGTGACTTGCTTTGAGCAAAGGG - Intergenic
1120102463 14:80461123-80461145 TGTGACTTGCTCAGGGTGACAGG + Intergenic
1120650223 14:87123620-87123642 TGTGACTTGCTTTGGCCAAAGGG - Intergenic
1121888410 14:97566071-97566093 TGTGAGTTGGTGTTGGTGATAGG + Intergenic
1122431230 14:101647500-101647522 TGTGACTGGCTTTGTGTGATTGG - Intergenic
1123163463 14:106302375-106302397 TGTGTCTTGCAGTGTGTAAATGG - Intergenic
1124725814 15:32154813-32154835 TGTGAGTGGCTGTGTGTGAGTGG - Intronic
1125105560 15:35967152-35967174 TGTGACTTGTTTTGGCTGACGGG + Intergenic
1125436694 15:39653246-39653268 TGGAACTTGCTCTGGGTGAGTGG + Intronic
1125484940 15:40105345-40105367 TGGGACTTTCTGTGTGTGAAAGG - Intronic
1125648593 15:41294324-41294346 TGTCACGTGCTGTGGATAAAGGG + Intergenic
1127181594 15:56425200-56425222 TGTGTCTTGCTGTGGGTCTCTGG + Intronic
1128471054 15:67953732-67953754 TGTTACTTTCTGTGAATGAAAGG - Intergenic
1128642175 15:69347759-69347781 TGTGTCTTCCTATGGCTGAAGGG + Intronic
1129233257 15:74208523-74208545 TCTGACTGGCTGTGGGCAAAAGG - Intronic
1129602665 15:77009388-77009410 TGTGATTTGCTGTAGGTGTGAGG - Intronic
1130045962 15:80444951-80444973 TGTGATGTGTTGTGTGTGAATGG + Intronic
1130813706 15:87408243-87408265 TGTGATTTGCAGTGGGAGAAAGG - Intergenic
1135876181 16:26202318-26202340 TGTGACTTGCTTTGACTAAAGGG + Intergenic
1136064620 16:27750346-27750368 TGTGACTTGCTGAGAGTCTATGG + Intronic
1136742421 16:32549064-32549086 TGTGACATGCTTTGTGTGTATGG + Intergenic
1136771852 16:32847155-32847177 TGTGTCTTGCAGTGTGTAAATGG + Intergenic
1136898756 16:34014366-34014388 TGTGTCTTGCAGTGTGTAAATGG - Intergenic
1137705013 16:50529077-50529099 TCTGACTTGCTGTGTGTCATTGG - Intergenic
1138739989 16:59296964-59296986 TGTGACTTGCTGTGGCCAACGGG + Intergenic
1139212077 16:65088150-65088172 TGTGTCTTCATGTGGCTGAAGGG - Intronic
1139609935 16:68048700-68048722 TGTGACTTGCTGGGGCTCATAGG + Intronic
1139981838 16:70865461-70865483 TGTGTCTGAATGTGGGTGAAGGG + Intronic
1140040475 16:71404151-71404173 TGAGACATGCTCTGGGTGAGGGG - Intergenic
1140331368 16:74060492-74060514 TGAGAGTTGCTGTGTGTAAATGG - Intergenic
1140863435 16:79039386-79039408 TGTGACTTCCTATGGGGGAAGGG - Intronic
1141019046 16:80477831-80477853 TGTGATTTGCTTTGGCTGAAGGG - Intergenic
1141550072 16:84800958-84800980 TGTGACTTGCTTTGATTGATGGG - Intergenic
1141570406 16:84930469-84930491 TGTGAGTGGGTGTGGGTGAGTGG + Intergenic
1141570448 16:84930639-84930661 GGTGAGTGGATGTGGGTGAATGG + Intergenic
1141570489 16:84930815-84930837 TGTGAGTGGGTGTGGGTGAGTGG + Intergenic
1141570518 16:84930915-84930937 TGTGAGTGGGTGTGGGTGAGTGG + Intergenic
1203074272 16_KI270728v1_random:1109244-1109266 TGTGTCTTGCAGTGTGTAAATGG + Intergenic
1142678531 17:1531236-1531258 TGTCTCTTGCTGTGGGAGACAGG - Intronic
1143285325 17:5784869-5784891 TGTGACTTGCTATGGCCAAAGGG - Intronic
1143483140 17:7238558-7238580 TGGGAGTTGCTGAGGGTGAGGGG - Intronic
1143644253 17:8219772-8219794 TGTGACTGGCTTTGGTTGATGGG - Intergenic
1145286144 17:21507160-21507182 GGGAACTTGCTGTGAGTGAAGGG - Intergenic
1147637412 17:41972521-41972543 TGTCAGTGGCTGTGGGTGTAAGG - Intronic
1149225030 17:54460073-54460095 TGTCCCTTGGTGTGGGTGCAGGG - Intergenic
1149286742 17:55173558-55173580 AATGACTTTCAGTGGGTGAATGG - Intergenic
1150038747 17:61834613-61834635 TGTGATTTGCTTTTGGTGACTGG + Intronic
1150667335 17:67153681-67153703 TCAGCTTTGCTGTGGGTGAAGGG - Intronic
1151308423 17:73278915-73278937 TGTTAAGTGCTGCGGGTGAAGGG + Intergenic
1152280728 17:79383641-79383663 AGGGACTTTCTGTGGGTGCAAGG + Intronic
1156501098 18:37558884-37558906 TGGGAAATGCAGTGGGTGAAGGG + Intronic
1156964378 18:43072885-43072907 TGTGGGATGCTGTGGGAGAAAGG + Intronic
1157298311 18:46461796-46461818 TGTGGCATCCTGTGGGTGACAGG + Exonic
1158069989 18:53459401-53459423 TCTGACTGGCTGTGGCTGACTGG - Exonic
1158522100 18:58180122-58180144 TGTGCATTGCCCTGGGTGAACGG + Intronic
1159964193 18:74579823-74579845 TGTGAGATGCTGTGGTTGGAAGG + Intronic
1162039168 19:7959380-7959402 AGTGACTTGCTTTGGGGGAGGGG - Exonic
1164918975 19:32074378-32074400 TGTGACTTGCTCTGGCCAAAGGG - Intergenic
1167153040 19:47720726-47720748 TGTGACTTTGTGTGGCTGCATGG + Intronic
1167297577 19:48660841-48660863 TGTTGTTTGCTGTGGGTGCAGGG + Intergenic
1167401705 19:49276103-49276125 TGTGACTTTCAGTGGGAGATGGG + Intergenic
1167486987 19:49768270-49768292 TGGGAATGGCTGTGGGTGATTGG + Intronic
925379187 2:3412854-3412876 TGTGCCTAGCTCTGTGTGAAAGG - Intronic
926165861 2:10521933-10521955 TGTGACTGGGTGTGGGGGAGGGG + Intergenic
927664615 2:25021953-25021975 TCTGACTTTCTTTGGGTGGAGGG + Intergenic
928413664 2:31073582-31073604 TGAGACATGCTGTGGGTTTAAGG + Intronic
929339822 2:40801704-40801726 TGTGACTTGGGGTGGGGGGAGGG - Intergenic
929461388 2:42104168-42104190 TATGGCTTGCTTTGGGGGAAAGG + Intergenic
930891556 2:56394500-56394522 TGTGTCTTGCTGTTGGTGAATGG - Intergenic
931605903 2:64051845-64051867 TATGACTAGCTTTGGGTAAAGGG - Intergenic
931999507 2:67871725-67871747 GGTGACTTGATGTGAATGAATGG - Intergenic
932456849 2:71855129-71855151 TGTGACTTGCTTTGGCAAAAGGG + Intergenic
932720244 2:74133556-74133578 TTTGACTGGCTGTTGGTAAAAGG + Intronic
932787891 2:74623396-74623418 TGGGACTTGAGGTGGGAGAATGG + Intronic
933860264 2:86459495-86459517 TGAGACTTGCTGAGGAAGAAGGG + Intronic
936142224 2:109950172-109950194 TGAGACTTGCTTTGGCTGATGGG + Intergenic
936178914 2:110248131-110248153 TGAGACTTGCTTTGGCTGATGGG + Intergenic
936202464 2:110421301-110421323 TGAGACTTGCTTTGGCTGATGGG - Intronic
936578104 2:113672074-113672096 TGTGGCTTTCTGTGGGTCATAGG - Intergenic
936847455 2:116854148-116854170 GGGGAGTTGCTGTGGGTGGAGGG - Intergenic
937951695 2:127392994-127393016 TGTGTCATCCTGTGGGGGAAGGG + Intergenic
940480628 2:154226040-154226062 TGTGACTGGCTTTGGGGAAACGG + Intronic
942048259 2:172113916-172113938 TGTGACAGCCTGTGGGGGAAGGG + Intergenic
942486546 2:176445869-176445891 TGTTATTTGCTGTGGGCAAATGG + Intergenic
945971271 2:216234180-216234202 TGTGAGTTGCTGTGGGGCCAAGG - Intergenic
948029627 2:234806605-234806627 TGTGGCAGGCTGTGGGTGACCGG - Intergenic
1169282198 20:4277349-4277371 TGAGACCTGCTGTGAGTGAGGGG + Intergenic
1169891538 20:10458518-10458540 TGGGACCTGTTGTGGGGGAAGGG - Intronic
1170932181 20:20779082-20779104 TGTGGCTTGCCTTGGGGGAAAGG - Intergenic
1172355540 20:34277176-34277198 TGTGACTGGCTGTGGTGGGAGGG - Intergenic
1172773538 20:37394948-37394970 TGTGTGTTGCTGTGTGGGAATGG + Intronic
1172971056 20:38873264-38873286 CTTGACTGGCTGTGGGTGAGGGG + Intronic
1174032470 20:47641203-47641225 GGCAACTTGCTGTGGGTGTATGG + Intronic
1174103912 20:48148632-48148654 TGTGCCTTTCTGTGGGGAAAGGG + Intergenic
1174351354 20:49970633-49970655 TCTCACCTGCTGTGGGTCAAAGG + Intergenic
1175746353 20:61459888-61459910 TGTGACCTTCTGTGGGTCACAGG - Intronic
1175794631 20:61764063-61764085 TGTAACTGGCTGTGGCTGCAAGG - Intronic
1175829313 20:61953460-61953482 TGTGACTTGCTTTGACTGAGGGG - Intronic
1177099887 21:16887412-16887434 TGTGACTTGCTTTGGGCAAAGGG - Intergenic
1177596830 21:23255520-23255542 TGGGGCTTGCTGTGTTTGAAGGG - Intergenic
1177984434 21:27955943-27955965 TGTGACATGCTGTGTGTGGAAGG - Intergenic
1181043611 22:20204385-20204407 AGTGCCTCGCTGAGGGTGAAGGG + Intergenic
1181405195 22:22679513-22679535 TTTGACCAGCTGTGGGAGAAAGG - Intergenic
1182475803 22:30575656-30575678 TGGGACTGGCTGTGGGTGGAAGG - Intergenic
1183084244 22:35476878-35476900 TGAGGCTTTCTGTGGGTGGATGG + Intergenic
1183330535 22:37218499-37218521 TGTGACTTGCTGTGGCTACTGGG - Intergenic
1185184302 22:49383686-49383708 TGTGTCTTGCTGTGGGTGCTGGG - Intergenic
1185235631 22:49711128-49711150 TGTGTCTTCCTGTGGTGGAAGGG + Intergenic
1185422118 22:50740582-50740604 TGTGGCTTTCTGTGGGTCATAGG + Intronic
949451596 3:4191293-4191315 TGTGGCTTGCTGTGTGAGTATGG - Intronic
950098948 3:10345747-10345769 TGAGGCTTCCTGAGGGTGAAGGG - Intronic
950471552 3:13189568-13189590 TGTCACTTGTAGTGGGTGCAGGG - Intergenic
951838649 3:27009518-27009540 TGTGACTTGCTTTAGGAGATTGG - Intergenic
951923412 3:27880437-27880459 TATGGCTTGCTTTGGGTGAGAGG - Intergenic
955875458 3:63485532-63485554 TGTGTCGAGCTGTGGGGGAATGG + Intronic
956161847 3:66363233-66363255 AGAGACTTGCTGTGGGTGCAGGG + Intronic
957432112 3:80124128-80124150 TATGACATTCTGTGGGTGCAGGG + Intergenic
960433163 3:117594822-117594844 TATGACTTCCTGAGGGTAAAAGG - Intergenic
961723431 3:128910553-128910575 AGTCACTTGCTGTTGGGGAAAGG + Intronic
962315506 3:134357100-134357122 TCTCACTTGCTGTGGGTGAGGGG - Exonic
962934441 3:140066773-140066795 TGTGAGTGTCTGTGAGTGAAAGG - Intronic
966594554 3:181713451-181713473 TGTCATTTGCTGTGGGTGATGGG - Exonic
968317148 3:197734753-197734775 TGTGACGTGCTTCGTGTGAAAGG - Intronic
968328963 3:197847433-197847455 TGTGACTTGCTGATAGTGACAGG - Exonic
969346181 4:6571537-6571559 TGGGTCTAGCTGAGGGTGAAAGG + Intergenic
969428359 4:7138842-7138864 TGGGACTTGCTGGGGCTGAGTGG + Intergenic
969881712 4:10179778-10179800 TGTGAATTGCTCTGGGTGGCAGG + Intergenic
970485269 4:16518902-16518924 TGTGACTTAGTGTGGGCGACTGG - Intronic
972527656 4:39931544-39931566 TGACACTTGCTGTTGTTGAAAGG + Intronic
972838292 4:42901861-42901883 TGTGACTTCCTTTGGCTGAAAGG + Intronic
973152867 4:46909580-46909602 TATGACTTGCTTTGGGTTACAGG - Intergenic
974432413 4:61816447-61816469 TGTGACTTGCTTTGGCTAATGGG - Intronic
976266541 4:83190632-83190654 TATGGCTTGCTTTGGGGGAAAGG + Intergenic
977099559 4:92793381-92793403 TGGGACTTTCTGAGGGTGGAGGG + Intronic
977252066 4:94700591-94700613 TGGGAATGGCTGTGGGTGCATGG - Intergenic
980077119 4:128305624-128305646 AGTGAGTTCCTGTGGGGGAAGGG + Intergenic
980391749 4:132156078-132156100 GGTGACTTGCAGTGACTGAAAGG - Intergenic
981321586 4:143397908-143397930 TGATACTTCCTGTGGCTGAAGGG + Intronic
983123263 4:163915638-163915660 TGTGAAATTCTGTGGGTGAGGGG + Intronic
983792574 4:171814990-171815012 TTTGACTTGAGGTGGATGAAAGG + Intronic
983798449 4:171896603-171896625 TGTGCCTTCCTGTGGTGGAAAGG + Intronic
983829807 4:172312549-172312571 TTTGGGTTGTTGTGGGTGAAAGG - Intronic
985875310 5:2590181-2590203 TGTGACTTGCTTTTTGTAAATGG + Intergenic
986236543 5:5915803-5915825 TGTGACTTTCTGTGTGTTATAGG - Intergenic
988873739 5:35420236-35420258 TGTCAGTTTCTGTGTGTGAAGGG - Intergenic
990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG + Intronic
992999161 5:82363180-82363202 TCTTACTTTCTGTGGGAGAAAGG + Intronic
993883251 5:93387691-93387713 TGTGACTGCCTGTGGGTGACAGG - Intergenic
995014038 5:107290028-107290050 TGTGACTGGCACTGGTTGAAAGG - Intergenic
996612576 5:125400323-125400345 TGTGACTTGCTTTGGCTAATGGG + Intergenic
997461256 5:134053930-134053952 TATGACTTCCTGTGGGTTACAGG + Intergenic
1001448060 5:171802120-171802142 TAAGACTTTCTGTGGGTAAATGG - Intergenic
1003880092 6:10472035-10472057 TGTGACTTGCTTTGGCTAATAGG - Intergenic
1003895803 6:10606333-10606355 TGTGACTTGCTTTTGGCCAATGG - Intronic
1005650310 6:27879492-27879514 TGTGAATTGCTTTAGGTGCAGGG - Intergenic
1006046143 6:31300375-31300397 TGTAACTGGCTGTGGTTGATGGG + Intronic
1006425425 6:33960162-33960184 AGTGCCTTGCAGTGGGAGAAAGG + Intergenic
1007727311 6:43924279-43924301 TGAGGCTTTCTGTGGGTGATTGG + Intergenic
1015114464 6:129632487-129632509 AGTGACTGGCAGTTGGTGAATGG - Intronic
1017564738 6:155671240-155671262 TGTTACTTACTTTGGGTGAAAGG + Intergenic
1018039404 6:159908853-159908875 TATGACTTCCTGGGGGTGACTGG + Exonic
1019487191 7:1294751-1294773 TGTGAGTGGATGTGGGTGCATGG + Intergenic
1020040070 7:4995286-4995308 AGTGACTTGCTCTGGGTCACTGG + Intronic
1020704361 7:11524993-11525015 TTTCACTTTCTGTGGATGAAAGG + Intronic
1021145027 7:17075680-17075702 TCTGTCTTGCAGTGGGTTAAAGG + Intergenic
1022145139 7:27530121-27530143 TGTGACTTGTTGTGGTTGTCTGG + Intronic
1024559308 7:50629918-50629940 TGTGAGTTGCTGCGGGACAAGGG - Intronic
1025974424 7:66358559-66358581 TGTGACTTGCGGTGCGTTGATGG + Intronic
1027551534 7:79603049-79603071 TGGGAGTTGCTGTTTGTGAAAGG - Intergenic
1032628197 7:133616351-133616373 TGTGACTAGCAGTGGGTTCATGG - Intronic
1033252501 7:139773173-139773195 TTTGAGTTCATGTGGGTGAAGGG + Intronic
1035177938 7:157065817-157065839 TGTGAGAAGCTGTGGGCGAAAGG + Intergenic
1039269423 8:35864451-35864473 TGTAAATTGCTGTGTGTGTAGGG - Intergenic
1040727795 8:50403936-50403958 TGTGACTTGCTGTAGGAGCATGG - Intronic
1041252307 8:55946232-55946254 TATCACTTGCTGTGGGTGGCAGG - Intronic
1041325364 8:56657985-56658007 AGTGACTTGATATGGGTGGATGG - Intergenic
1041727709 8:61033437-61033459 TGTGACTTGCTCTGGATAATGGG - Intergenic
1041760602 8:61362187-61362209 TGTGACTTCCTGTGGTAGGAAGG + Intronic
1044789644 8:95834476-95834498 TGTGACTTGCTGTGGCCAATGGG - Intergenic
1044817862 8:96131360-96131382 TGTCACTTGCTGTGTGTGCCAGG - Intergenic
1047376509 8:124302755-124302777 TGCCATTTGCTGTGGGTGATGGG - Intergenic
1047454488 8:124997379-124997401 TGTGACTTGGTGAAGGTCAATGG + Intergenic
1047590246 8:126319380-126319402 TGGGCCTTGAAGTGGGTGAAGGG - Intergenic
1049323215 8:142008415-142008437 TGTGTCTGGGTGTGGGTGATGGG - Intergenic
1049502803 8:142976611-142976633 TGTGACCTCATGTGGGGGAAGGG - Intergenic
1049576058 8:143390180-143390202 GGTGACTGACTGTGGGTGAGTGG + Intergenic
1050397644 9:5216193-5216215 TGTGACTTGCTGTTATTGAAAGG + Intergenic
1050402275 9:5268740-5268762 TGTAACTTGCTGTTATTGAAAGG + Intergenic
1053593622 9:39536434-39536456 TGTGACTTGCCTTGGGGAAAAGG + Intergenic
1054202642 9:62100141-62100163 TGTTCCTTGCTGTGGGAGGAGGG + Intergenic
1054572683 9:66828847-66828869 TGTGACTTGCCTTGGGGAAAAGG - Intergenic
1054635720 9:67488224-67488246 TGTTCCTTGCTGTGGGAGGAGGG - Intergenic
1055277772 9:74639307-74639329 TGTGACTTACTGTGGACCAATGG - Intronic
1059112961 9:111574058-111574080 TGTGACTTGCTGTGGGTGAAGGG - Intronic
1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG + Intronic
1059403056 9:114082456-114082478 TGTGGCTTGCTGCGGGACAATGG + Intergenic
1059844407 9:118257325-118257347 TGTAGATTGCTTTGGGTGAACGG + Intergenic
1060861310 9:126957001-126957023 TGTGACTTGCTGTGAGTTAGTGG - Intronic
1062439478 9:136563322-136563344 TGTGACAGGCTTTGGGTCAAGGG - Intergenic
1062686088 9:137814156-137814178 GGTGACGTGGGGTGGGTGAAGGG - Intronic
1186468659 X:9804287-9804309 TGTGGCCTGCTGTGGCTGATGGG + Intronic
1186820306 X:13281356-13281378 TGTCAGTTGCTGTGGCAGAAGGG - Intergenic
1187231917 X:17431509-17431531 TGTGACTGGCTGTGATTGAAGGG + Intronic
1189191606 X:39113185-39113207 TGTGACATGCTTTGGCTGATGGG - Intergenic
1189205854 X:39238251-39238273 GGTGACTCGCTGTTGGGGAAAGG - Intergenic
1189740074 X:44108497-44108519 TGTGTCCTTCAGTGGGTGAAAGG - Intergenic
1190625390 X:52332483-52332505 TATGTCTTTCTGTAGGTGAATGG - Intergenic
1193391226 X:80931487-80931509 GGGGAGTTGCTGTGGGTTAAGGG - Intergenic
1194613237 X:96070025-96070047 TGTGACTTGCAGAAGGAGAAAGG - Intergenic
1196312132 X:114181292-114181314 TGTGACTTGCTTTGGCTAATGGG + Intergenic
1196376504 X:115039127-115039149 TGTGGATAGCTGTGGGAGAATGG - Intergenic
1197051007 X:122059742-122059764 TGTGACTTGCTTTGGCTAAATGG + Intergenic
1199499484 X:148494183-148494205 TGTGTTGTTCTGTGGGTGAAAGG - Intergenic
1201667982 Y:16480780-16480802 TGTGTTTTGCTTTGGGTCAAAGG + Intergenic
1201756652 Y:17493949-17493971 TGTGACGTGCTGTGGGAGTGGGG - Intergenic
1201844901 Y:18412035-18412057 TGTGACGTGCTGTGGGAGTGGGG + Intergenic