ID: 1059113269

View in Genome Browser
Species Human (GRCh38)
Location 9:111577318-111577340
Sequence TGGTGAGTATGTAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23379
Summary {0: 1, 1: 6, 2: 87, 3: 1340, 4: 21945}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059113267_1059113269 22 Left 1059113267 9:111577273-111577295 CCTACTAGGATGGTTATAATAAA 0: 4
1: 82
2: 320
3: 781
4: 1700
Right 1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG 0: 1
1: 6
2: 87
3: 1340
4: 21945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059113269 Original CRISPR TGGTGAGTATGTAGAGAAGT TGG Intronic
Too many off-targets to display for this crispr