ID: 1059114227

View in Genome Browser
Species Human (GRCh38)
Location 9:111586436-111586458
Sequence CACCTTGAGCCACAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059114227_1059114231 6 Left 1059114227 9:111586436-111586458 CCTCTGTCCTGTGGCTCAAGGTG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1059114231 9:111586465-111586487 ACACTAGCCTTCTCTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059114227 Original CRISPR CACCTTGAGCCACAGGACAG AGG (reversed) Intronic
900572608 1:3366113-3366135 CCCCCTGAGCCACAGGTCAAGGG - Intronic
900641110 1:3688485-3688507 GACCCTGGGCCGCAGGACAGGGG - Intronic
900980679 1:6044473-6044495 CAGCCTGAGCCACAGCTCAGAGG + Intronic
901749621 1:11397737-11397759 CCCCCTGAGACACAAGACAGAGG - Intergenic
904382570 1:30121290-30121312 ACCCTTAAGCCACAGCACAGTGG + Intergenic
905183610 1:36180732-36180754 CACCTTGGGCCACAGGATACTGG + Exonic
906695512 1:47820655-47820677 GCCCTTGAGTCACAGGACACAGG - Intronic
906805223 1:48774226-48774248 CACCTGGTGCCATAGCACAGTGG + Intronic
907501341 1:54883771-54883793 CACCTGCAACCACAGGACAGAGG + Exonic
911712936 1:101095930-101095952 ACCCCTGAGCCACTGGACAGGGG + Intergenic
912712191 1:111958012-111958034 CACCCTGAGTTGCAGGACAGTGG - Intronic
915440968 1:155945261-155945283 CACCTTCAGCCCCAGAACATGGG - Intergenic
916945918 1:169727374-169727396 CATGTGGAGCCACAGGACACTGG - Exonic
917397002 1:174604077-174604099 GACCCTGAGCCAGAGGACATGGG - Intronic
918076155 1:181173071-181173093 CACCTGGGGCCAGAGGTCAGGGG - Intergenic
920114057 1:203607474-203607496 CACCAAGACCCACAGGAAAGAGG + Intergenic
921297556 1:213718912-213718934 CACTTTGAGTGACAAGACAGTGG + Intergenic
921418856 1:214922747-214922769 CCCCTGGATCCACAGGACACTGG + Intergenic
922682982 1:227616334-227616356 CACCCTGAGCCTGAGGCCAGAGG - Intronic
923085008 1:230696557-230696579 CACCTCCAGCCACAGGACGCTGG - Intergenic
923595947 1:235361048-235361070 CTCCCTGTGCCACAGGGCAGGGG - Intergenic
924301452 1:242642972-242642994 CAACCTGAGCCACATGACACAGG - Intergenic
924773327 1:247095924-247095946 CCCCTTGTGCCACAGCAAAGAGG - Intergenic
1063980776 10:11450041-11450063 CAACTTAAGCGAGAGGACAGAGG - Intergenic
1066201862 10:33149744-33149766 CACCATGAGCCACAAGGCAATGG + Intergenic
1067752634 10:48982223-48982245 CACCTGGAGGCACTGGAGAGAGG + Intronic
1068123219 10:52806154-52806176 CACCTGGGAGCACAGGACAGTGG - Intergenic
1069015521 10:63425045-63425067 CACCTAGAACTACAGGACACAGG + Intronic
1069356942 10:67597729-67597751 CACCTGCAGCAACAGGGCAGTGG + Intronic
1069630889 10:69896481-69896503 CACCATGGGGCACATGACAGCGG - Intronic
1071931866 10:90481368-90481390 CACCTGGAACCACAAGAAAGCGG - Intergenic
1076699882 10:132265877-132265899 CACCTTGACCCACATGCTAGGGG + Intronic
1076723318 10:132402164-132402186 GATCTTCAGCCACAGGCCAGGGG - Intronic
1076766922 10:132640853-132640875 CACCTCCAGCCACAGGACCACGG - Intronic
1077018748 11:408152-408174 CACGTTGACCCCCAGGACACTGG + Exonic
1077473521 11:2775897-2775919 CACTTTGAGCCACATGGCTGGGG + Intronic
1078510953 11:11983626-11983648 AAGCTGCAGCCACAGGACAGAGG + Intronic
1079984266 11:27183842-27183864 GAATTTGAGCCAAAGGACAGAGG + Intergenic
1080674603 11:34413128-34413150 CACCTCCAACCATAGGACAGAGG - Intergenic
1081662934 11:44899509-44899531 CAGCTTCAGCCTCAGGAGAGGGG - Intronic
1082029794 11:47595724-47595746 AAGCTTGGGCCACAGGACTGTGG + Intergenic
1083965214 11:66039651-66039673 CAGCTTCAGCCACAAGCCAGGGG - Intergenic
1084316996 11:68351370-68351392 CTCCTGGAGCCACAGTGCAGGGG - Intronic
1084404298 11:68962104-68962126 GGCCCTGAGCCACAGAACAGGGG + Intergenic
1085382340 11:76131364-76131386 CAGCTTGGGCCAGTGGACAGAGG - Intronic
1086946860 11:92852404-92852426 TTCCTTGAGCCACAAGAGAGTGG + Intronic
1090352353 11:126115445-126115467 CACCCTCAGCCACAGGCCAGAGG - Intergenic
1090419257 11:126562759-126562781 CCCCTACAGCCACAGGACAGAGG - Intronic
1090437246 11:126697044-126697066 CACCCTGAGCGAAAGAACAGTGG - Intronic
1091345969 11:134854388-134854410 CACCTTGAACCACAGAAAAGAGG + Intergenic
1094026246 12:25962234-25962256 CAGCATGAGCCACAGGCCTGAGG - Intronic
1094130026 12:27064601-27064623 CAGCCTGAGCCCCAGGGCAGAGG - Intronic
1094179485 12:27576597-27576619 CAGCCTGAGCCCCAGGGCAGAGG - Intronic
1095779376 12:46042257-46042279 CACCTTGATCGTCATGACAGAGG - Intergenic
1096789951 12:54038432-54038454 CACCTTGGGCCACTGGCCAAGGG - Intronic
1096815238 12:54197679-54197701 GGGTTTGAGCCACAGGACAGAGG - Intergenic
1099137967 12:78932043-78932065 CACCTTGTGGCAGAGGAAAGTGG - Intronic
1100134515 12:91538674-91538696 CACCTGGAGCCACTGGTCAGAGG - Intergenic
1101331057 12:103758251-103758273 CTCTTTGTGCCACAGAACAGTGG + Exonic
1102491125 12:113290167-113290189 CACCGTGGGCAACAGGACCGTGG + Exonic
1104357353 12:128099508-128099530 CACCCTGAGCCACATCACAATGG - Intergenic
1104674035 12:130700611-130700633 CACCTGGAGCCACTGGAAACTGG + Intronic
1104745550 12:131208101-131208123 CACCGTGAGGCCCAGGAGAGGGG - Intergenic
1104788792 12:131469008-131469030 CACCGTGAGGCCCAGGAGAGGGG + Intergenic
1105702228 13:22942207-22942229 GCCTTTGACCCACAGGACAGTGG + Intergenic
1105854847 13:24363992-24364014 GCCTTTGACCCACAGGACAGTGG + Intergenic
1105998990 13:25701495-25701517 CCCCTTGATCAACAGGGCAGTGG - Intronic
1106552993 13:30787749-30787771 CACCTGGAGCCACAAGATGGGGG - Intergenic
1110045083 13:70817946-70817968 CACTTGGAGCTACAGGATAGTGG - Intergenic
1111741363 13:92209420-92209442 CACACTCTGCCACAGGACAGAGG - Intronic
1111977161 13:94978283-94978305 CACCTTGAGCTAATGGGCAGTGG + Intergenic
1113760646 13:112844038-112844060 CACAATGAGCCTCAGTACAGGGG + Intronic
1114463496 14:22903590-22903612 CACAGTGACCCACAGGGCAGAGG - Intronic
1114990893 14:28287924-28287946 CACTTTTAGTCATAGGACAGGGG - Intergenic
1115331673 14:32204255-32204277 CACCTGCACCCACAGGTCAGGGG - Intergenic
1115774927 14:36704776-36704798 CACCTGAAGCCATATGACAGGGG - Intronic
1120523824 14:85554859-85554881 CACCTTCAGCCACAGGGAAAAGG - Intronic
1121482623 14:94290726-94290748 CTACTTGAGCCACAGGAAGGAGG - Intronic
1121764213 14:96471773-96471795 CACCTTGAGCCACCATCCAGGGG - Intronic
1122126009 14:99579212-99579234 GAACTTCAGCCCCAGGACAGGGG - Intronic
1123034365 14:105465950-105465972 CACCTCTTCCCACAGGACAGGGG - Intronic
1124551940 15:30689185-30689207 CACAGAGAGCAACAGGACAGCGG - Intronic
1124679306 15:31716486-31716508 CACAGAGAGCAACAGGACAGCGG + Intronic
1125081563 15:35679796-35679818 AACCTTGAGCTAAAGTACAGTGG - Intergenic
1127368418 15:58312742-58312764 CACCCTGAGCTACAAGACATGGG - Intronic
1128054753 15:64691362-64691384 CCCCTTGAGCAGCAGCACAGTGG + Intronic
1129610875 15:77055338-77055360 CCCCTTGTTCCTCAGGACAGGGG + Intronic
1129931576 15:79415321-79415343 CACAGGGAGCCACAGGTCAGTGG + Intronic
1132688145 16:1170852-1170874 AACCCTGACCCACAGGACCGGGG - Intronic
1132766670 16:1537833-1537855 CACGTGGAGCCACCGGAGAGAGG - Intronic
1133054168 16:3137257-3137279 AACCCTGAGCCTCAGGCCAGGGG + Exonic
1133512275 16:6471687-6471709 GACCATGAGCCACAGGGAAGAGG + Intronic
1133612543 16:7447097-7447119 TACCTTGAGGCCGAGGACAGTGG - Intronic
1134261558 16:12655062-12655084 GACATTGGGGCACAGGACAGAGG + Intergenic
1136047337 16:27624868-27624890 CACCATGGCCCATAGGACAGAGG + Intronic
1140470901 16:75213780-75213802 CACCCTGAGACACAGGGCAAGGG - Intergenic
1140728628 16:77836298-77836320 CACCGTGAGCCCCAGGATAAGGG + Intronic
1140902774 16:79384911-79384933 CACCTTATGCACCAGGACAGAGG + Intergenic
1141557919 16:84848179-84848201 GACCTTGAGCCGCAGGGAAGCGG + Intronic
1142057013 16:88004364-88004386 CCCCTTGAGCAACAGGGCACCGG + Exonic
1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG + Intergenic
1144404772 17:14941790-14941812 CACCTTGGGAGAGAGGACAGGGG + Intergenic
1147322417 17:39654123-39654145 CAACTGGAGCCAGAGGGCAGTGG - Intronic
1148068652 17:44893032-44893054 TAGGTTGAGCCACAGGTCAGGGG - Intronic
1148861012 17:50604344-50604366 CAGCTTGAGCCATAGGACCCAGG - Intronic
1151570581 17:74923570-74923592 CGTCCTGAGCCCCAGGACAGTGG + Intergenic
1151755232 17:76071966-76071988 CACCTTGAGCCACTGAACTGGGG - Intronic
1152340497 17:79721522-79721544 CACCAGGAGCCACAGGAGACAGG - Intergenic
1152789152 17:82269252-82269274 CGCCTTGAGCAGCAGGACAAAGG + Intronic
1154075104 18:11192624-11192646 CCACTTGAACCACAGTACAGTGG + Intergenic
1155322572 18:24633278-24633300 GACAGTGAGTCACAGGACAGGGG - Intergenic
1158520012 18:58164123-58164145 CACCAAGGGCCACAGCACAGGGG - Intronic
1158520297 18:58166805-58166827 CACCAAGGGCCACAGCACAGGGG - Intronic
1159478734 18:68959767-68959789 CACCATGAGCCAGGGGACAGTGG - Intronic
1159898391 18:74019220-74019242 TACCTTCAGCCAGAGGACAGTGG + Intergenic
1159939087 18:74392422-74392444 CACCTGGAGACTCAGGCCAGAGG - Intergenic
1159968509 18:74620843-74620865 CACGTAGAGCCACAGGTCATCGG - Intronic
1160417638 18:78722154-78722176 CACCTGGTGCCGGAGGACAGTGG + Intergenic
1160463293 18:79055467-79055489 CACCTGGAGCCACACGGCACTGG - Intergenic
1160660341 19:295245-295267 GACCTCGAGCCACAGGACCAGGG + Intergenic
1162754965 19:12852336-12852358 CATCTGGAGGAACAGGACAGTGG + Exonic
1164043560 19:21513731-21513753 CACCTGGAATCACAGGACAATGG - Intronic
1165158646 19:33803117-33803139 CACCTTGAGCCCCAGCCCTGGGG - Intronic
1165675607 19:37719804-37719826 CACCCTAAGCCTCAGGCCAGGGG - Intergenic
1165888825 19:39098728-39098750 CAGCCTGAGCCACCGGCCAGTGG - Intronic
1167099981 19:47398855-47398877 CACATTCAGCAACAGGACACGGG + Intergenic
1167604667 19:50475453-50475475 CACCTGGGGCCAGAGGTCAGAGG + Exonic
925162295 2:1694461-1694483 GAACTTGACCCACAGCACAGGGG - Intronic
925368296 2:3325845-3325867 CACCTGAAGCCACAGGATAAGGG - Intronic
927704927 2:25291072-25291094 CACTGCCAGCCACAGGACAGAGG + Intronic
927754427 2:25697447-25697469 CACCCAGAGCCACATCACAGAGG + Intergenic
928074742 2:28253892-28253914 TAGTTTGTGCCACAGGACAGGGG - Intronic
928428345 2:31197827-31197849 CACCTGGAGCCACTGGAAGGTGG + Intronic
930683296 2:54280578-54280600 CACCTAGAGACACAGGAGGGAGG + Intronic
932172138 2:69566809-69566831 CACCTAGAACCACAGCACATTGG + Intronic
933939411 2:87232899-87232921 CACATTTATCCAAAGGACAGGGG + Intergenic
934759325 2:96844726-96844748 CCCCTCCAGCCACAGGAAAGGGG + Intronic
936353722 2:111732879-111732901 CACATTTATCCAAAGGACAGGGG - Intergenic
938093725 2:128448722-128448744 AACCCTGAGCAACAGGAGAGGGG + Intergenic
938344480 2:130557323-130557345 CACCTTGAGCCTGTGGAGAGAGG - Intergenic
938345353 2:130563399-130563421 CACCTTGAGCCTGTGGAGAGAGG + Intergenic
939766987 2:146262863-146262885 CACCTTAAGCCAGAGGTCAGTGG + Intergenic
942229948 2:173851419-173851441 CAACTTGATCCACAGGAGGGAGG + Intergenic
942717840 2:178914582-178914604 CTCCTGGAGCCACTGGACAAAGG + Intronic
943043619 2:182832260-182832282 CAACTTGAGCCTGAGGACAGAGG - Intergenic
945843420 2:214915155-214915177 CACCTTGAACTACAGGGCACAGG - Intergenic
947299672 2:228675245-228675267 GACCTTGGGCCACATTACAGTGG - Intergenic
947422059 2:229950059-229950081 CACCCTGAGCTCTAGGACAGGGG + Intronic
948754900 2:240153795-240153817 CACCAGGAGCCAGAGGTCAGTGG + Intergenic
1169328408 20:4696630-4696652 CACCTTGAGTCCCATGACAATGG + Intronic
1170764416 20:19277930-19277952 CTCCTTGACCCAGAGAACAGTGG + Intronic
1170764699 20:19279979-19280001 CTCCTTGACCCAGAGAACAGTGG - Intronic
1174065187 20:47859724-47859746 CACGTGGAGCCACAGCACACTGG - Intergenic
1174209505 20:48866350-48866372 GGCCTTGAGCCACAGGACCCAGG - Intergenic
1174520190 20:51123420-51123442 CACAGTGAGCCCCAGGACTGGGG + Intergenic
1174571036 20:51501453-51501475 CACCTTGAGCATCAGTACAGAGG - Intronic
1175182051 20:57155653-57155675 CACATTGATCAACAGAACAGAGG + Intergenic
1176085374 20:63293393-63293415 CCCTGTGAGCCACAGGACCGGGG + Intronic
1176256552 20:64156058-64156080 CACCCTGAGGCAGAGGAAAGTGG - Intronic
1176347370 21:5761968-5761990 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
1176354184 21:5882552-5882574 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
1176497457 21:7562487-7562509 CTTCTTGAGCCCCTGGACAGTGG + Intergenic
1176541691 21:8160038-8160060 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
1176560642 21:8343083-8343105 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
1177486145 21:21758772-21758794 CACCTCCAGCCAAGGGACAGGGG + Intergenic
1179405524 21:41122323-41122345 CTCCCTGAGCCCTAGGACAGTGG + Intergenic
1180036630 21:45253711-45253733 AACCTTGACCCAGAGGACTGTGG - Intergenic
1181052622 22:20244972-20244994 GGCCTGGAGCCACAGGACAGTGG - Intronic
1181807447 22:25383638-25383660 CTCCTGGAGCCACAGGGCAGAGG + Intronic
1182519517 22:30877493-30877515 CACCTTAAGCCAAGTGACAGAGG - Intronic
1183778901 22:39985855-39985877 CAACTTCACCCACATGACAGAGG - Intergenic
1183828669 22:40406684-40406706 CACCTTGACCCACAGCACACGGG + Intronic
1184468640 22:44683430-44683452 CACCCAGAACCACAAGACAGAGG + Intronic
1203246630 22_KI270733v1_random:76457-76479 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
950009528 3:9712978-9713000 CACCATCTGCCACAAGACAGAGG + Exonic
951251053 3:20394710-20394732 CACCTTCAGGCACAGTAAAGTGG + Intergenic
952826724 3:37530606-37530628 CACCTTGAGCAACATGTCAAAGG + Intronic
952877996 3:37963895-37963917 CACCTTGTGCCACCGCACTGTGG - Intronic
954292326 3:49656194-49656216 CACCATGGGCCGCAGGACTGAGG - Exonic
959108336 3:102092031-102092053 CATCTGAAGCCAGAGGACAGAGG + Intergenic
961096054 3:124157893-124157915 CACCTGGAGCAACAGGACTCAGG - Intronic
961679603 3:128590730-128590752 GACCGTGGGGCACAGGACAGTGG - Intergenic
962056135 3:131873769-131873791 TGCATTGAGCCCCAGGACAGCGG + Intronic
962825125 3:139094400-139094422 CACCTTGGGCCAGAGGAGTGTGG - Intronic
963633727 3:147767205-147767227 CTGCTTTAGGCACAGGACAGAGG + Intergenic
964642001 3:158918349-158918371 CACACTTAGCCACAGGGCAGAGG - Intergenic
964946190 3:162227346-162227368 CAACTTGAGGCACAGGATGGTGG - Intergenic
965520579 3:169665319-169665341 CACCTTTATGCACAGGACAGCGG - Intergenic
966888356 3:184388932-184388954 TTCCCCGAGCCACAGGACAGTGG - Exonic
967688207 3:192442092-192442114 CAACTAGAGACAGAGGACAGAGG + Intronic
968671158 4:1852365-1852387 CACCTAGCTCCACAGGACAAAGG - Intronic
969721224 4:8893914-8893936 CGCATTGGGCCACACGACAGGGG - Intergenic
976781421 4:88762612-88762634 CACCATGGGCCATAGGACATAGG - Intronic
978672258 4:111263986-111264008 TACTTGAAGCCACAGGACAGAGG - Intergenic
981599993 4:146476580-146476602 CACCCTGAGCCACAGTCTAGTGG + Intronic
982719990 4:158849355-158849377 CACTTTGAACCAAAGGACACTGG - Intronic
985871753 5:2562923-2562945 CACCCAGAGCCACTGGACAGTGG + Intergenic
987110349 5:14680378-14680400 TACCTGGACACACAGGACAGAGG + Intronic
987382898 5:17302354-17302376 CACCTTGAGTCACAGGCTTGAGG + Intergenic
987677817 5:21097942-21097964 CAGCTTCAGCCTCAGGAAAGTGG - Intergenic
988371430 5:30373222-30373244 CATTCTGAGCCACAGGGCAGGGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
990842149 5:60094171-60094193 CACTTTGAGACTCAGGAAAGAGG - Intronic
996843476 5:127874164-127874186 TACCGTGAGCCACAACACAGAGG - Intergenic
997580291 5:135012667-135012689 CCCCTGAAGCCACAGGACAGGGG + Intergenic
999241910 5:150132818-150132840 GTCTTTGAACCACAGGACAGTGG + Exonic
1001690379 5:173628533-173628555 CACATTGAGCCACACTGCAGTGG - Intergenic
1003565739 6:7220721-7220743 CACTTAGAGCCACAGGAGAGGGG - Intronic
1003686138 6:8304560-8304582 TACCTTGTACCAAAGGACAGTGG + Intergenic
1003748806 6:9032842-9032864 ATCCTTGAGCCTCAGGACTGAGG - Intergenic
1006257108 6:32840694-32840716 CCCATTCAGCCACAAGACAGAGG + Intergenic
1007217446 6:40251291-40251313 CACCTTTACCCACAAAACAGGGG - Intergenic
1007497108 6:42267858-42267880 GACCTTGAGTCACATGCCAGGGG - Intronic
1012587052 6:100936117-100936139 CACCCTGAGACACATTACAGTGG - Intergenic
1016777581 6:147921750-147921772 CACCATGGGCAACAGGCCAGGGG - Intergenic
1018931646 6:168243998-168244020 CACCTTCAGCTACAGAAAAGGGG - Intergenic
1018966717 6:168495685-168495707 CCCCTTTGGCCACAGGACACAGG + Intronic
1019323951 7:428887-428909 CACCTTCACCCACAGGCCACGGG - Intergenic
1019501168 7:1365392-1365414 TACCTTGAGCCACAGCAAAGGGG + Intergenic
1019704111 7:2489385-2489407 CCCCATGAGCCAGAGGACACTGG + Intergenic
1019742784 7:2683033-2683055 AAACTCGAGCCACAGAACAGGGG - Intronic
1021472410 7:21019986-21020008 CACATTCAACCACAGGACTGTGG - Intergenic
1023766284 7:43514035-43514057 AACCATGAACCAGAGGACAGAGG + Intronic
1024915273 7:54492089-54492111 CACCTTTATCCCCAGAACAGAGG - Intergenic
1025851425 7:65247755-65247777 CACCTACAATCACAGGACAGAGG + Intergenic
1026153470 7:67807842-67807864 CACCTTGAGAGCCAGGACTGTGG - Intergenic
1034940639 7:155228175-155228197 CGCCTCCAGCCCCAGGACAGTGG - Intergenic
1035236478 7:157500773-157500795 CGCCTTCAGCCACCGGCCAGTGG + Intergenic
1035659065 8:1333282-1333304 CACCTCGAGTCTCAGGACACGGG + Intergenic
1037336222 8:17794790-17794812 CACCTTGACACAGAGGTCAGGGG + Intronic
1037477771 8:19274264-19274286 CACCATCAGCCAGTGGACAGGGG + Intergenic
1039977870 8:42382617-42382639 CTCCTTTAGCCACAGAACAAAGG + Intergenic
1044317893 8:90770984-90771006 CATCTTGAGCCCCATAACAGAGG - Intronic
1047940966 8:129827022-129827044 CACTTTGAGAACCAGGACAGAGG - Intergenic
1049254736 8:141607789-141607811 GTCCTTGGGCCACAGGCCAGTGG + Intergenic
1049472309 8:142781968-142781990 CCCCTGGAGGCACAGGGCAGAGG + Intergenic
1051715453 9:19978269-19978291 CATCTTTAGCAAAAGGACAGAGG + Intergenic
1053461571 9:38275465-38275487 GAACTTGAGACACAGGAAAGAGG - Intergenic
1055126990 9:72730392-72730414 CACCTTGAACTAAAGGACACTGG - Intronic
1055300632 9:74878228-74878250 GTCCTTGAGCCCCTGGACAGTGG - Intronic
1055873141 9:80909319-80909341 GGCCTTCAGCCACAGGACAATGG + Intergenic
1057065751 9:92049340-92049362 CTCCTGGAGCCTCAGGGCAGAGG - Intronic
1057171635 9:92966497-92966519 CACCTTGTGGCACAGAGCAGGGG - Intronic
1057763279 9:97893263-97893285 TACCTAGAGGCAGAGGACAGAGG + Intergenic
1059114227 9:111586436-111586458 CACCTTGAGCCACAGGACAGAGG - Intronic
1059320417 9:113464253-113464275 CTCCCTGAGCCAAAGGAAAGTGG - Intronic
1062662737 9:137647270-137647292 AACCTGGAGCCACAGCAAAGAGG - Intronic
1203462964 Un_GL000220v1:59519-59541 CTTCTTGAGCCCCTGGACAGTGG - Intergenic
1188229853 X:27647984-27648006 TAACTTGGGCCACATGACAGAGG + Intronic
1191997606 X:67113160-67113182 ATCCTCGTGCCACAGGACAGAGG + Intergenic
1195421834 X:104684185-104684207 CACTTTGAACCACAGATCAGTGG - Intronic
1195554295 X:106204148-106204170 CACCAGGATCCACATGACAGTGG + Exonic
1197524369 X:127544542-127544564 CACCATGAAGCAAAGGACAGAGG - Intergenic
1198521990 X:137462214-137462236 GACCTTGAGCCAGAGGACCCAGG + Intergenic
1199358385 X:146887179-146887201 CACCCTGAGGCAAAGGACACAGG + Intergenic
1200792530 Y:7312472-7312494 CACCTAGAACGACAGCACAGCGG - Intergenic
1202261137 Y:22971677-22971699 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202414125 Y:24605418-24605440 CACCTTTAGCAACGTGACAGGGG + Intergenic
1202456659 Y:25064668-25064690 CACCTTTAGCAACGTGACAGGGG - Intergenic