ID: 1059114706

View in Genome Browser
Species Human (GRCh38)
Location 9:111590653-111590675
Sequence CAGAAAAATTACATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1203
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 1125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059114706_1059114710 27 Left 1059114706 9:111590653-111590675 CCAGCCTTCATGTAATTTTTCTG 0: 1
1: 0
2: 5
3: 72
4: 1125
Right 1059114710 9:111590703-111590725 TTAAAAATATACATTTCTTTGGG No data
1059114706_1059114709 26 Left 1059114706 9:111590653-111590675 CCAGCCTTCATGTAATTTTTCTG 0: 1
1: 0
2: 5
3: 72
4: 1125
Right 1059114709 9:111590702-111590724 GTTAAAAATATACATTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059114706 Original CRISPR CAGAAAAATTACATGAAGGC TGG (reversed) Intronic
900549022 1:3244445-3244467 CAGGAAAATTAAATAAACGCAGG + Intronic
900751566 1:4401121-4401143 CAGACACATCACATGGAGGCAGG - Intergenic
900901995 1:5523473-5523495 CAGAAAAATCACTTGAACCCGGG + Intergenic
901182831 1:7353182-7353204 CAATAAAATTACATGAGGGCAGG + Intronic
901338424 1:8471902-8471924 CAGAAGAATCACATGAATCCGGG - Intronic
901370939 1:8797283-8797305 CAGAAGAATTACTTGAACCCAGG + Intronic
901474593 1:9480851-9480873 CAGGAGAATTACATGAAGCTGGG - Intergenic
902524689 1:17048801-17048823 CAGAAGAATCACTTGAAGTCGGG - Intronic
902596377 1:17512409-17512431 CAAAAAAATTAAATGTAGGCTGG - Intergenic
902811748 1:18891933-18891955 CAGAAGAATCACATGAACCCGGG + Intronic
902827204 1:18984296-18984318 CAGAAAGAGTCCTTGAAGGCAGG + Intergenic
902909979 1:19588661-19588683 CAGAAGAATCACATGAACCCAGG - Intergenic
903037943 1:20506755-20506777 CAGGAAAATCACTTGAACGCGGG + Intronic
903054891 1:20629013-20629035 CAGAAGAATTACTTGAACCCAGG + Intergenic
903251525 1:22057475-22057497 CAGGAAAATTACTTGAATCCAGG - Intronic
903312379 1:22469647-22469669 CAGGAAAATTGCCTGAAGCCAGG - Intronic
903562609 1:24239194-24239216 CAGGAGAATTACTTGAACGCGGG + Intergenic
903624199 1:24719662-24719684 CAGAAGAATTGCTTGAAGCCAGG - Intergenic
903711253 1:25326404-25326426 CAGAAAAATCACTTGAACCCGGG + Intronic
903715695 1:25365025-25365047 CAGAAAAATCACTTGAACCCGGG - Intronic
903820969 1:26102290-26102312 CAGAGAAAGTCCATGAGGGCAGG + Intergenic
903863678 1:26381723-26381745 CAGAAGAATTACTTGAACCCAGG + Intergenic
903909748 1:26714504-26714526 CAGAAAAATCACTTGAACCCAGG - Intronic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
904103847 1:28059811-28059833 CAGAAAAATTGCTTGAACCCGGG - Intronic
904166372 1:28558484-28558506 CAGGAAAATTGCCTGAACGCGGG - Intronic
904188124 1:28721911-28721933 CAGAAGAATTACTTGAACTCGGG - Intergenic
904226696 1:29026997-29027019 CAGAAAAATCACTTGAACCCAGG + Intronic
904262064 1:29293565-29293587 CAGAAGAATGGCATGAATGCGGG - Intronic
904292008 1:29492632-29492654 CAGACAAATCACCTGAAGTCAGG + Intergenic
905568983 1:38989112-38989134 CAGAAAAATTGCTTGAACCCGGG + Intergenic
905761589 1:40562962-40562984 CAGGAGAATTGCTTGAAGGCGGG - Intergenic
905994979 1:42373928-42373950 CATAAAAAATACATCTAGGCTGG - Intergenic
906029862 1:42710180-42710202 CAGGAAAATCACTTGAAGCCAGG + Intergenic
906221631 1:44084776-44084798 CTAAAAACATACATGAAGGCAGG + Intergenic
906336478 1:44936281-44936303 TAGAAAAGTTACATGTGGGCTGG + Intronic
906395909 1:45464329-45464351 CACAAAAATTGCTTGAAGCCGGG + Intronic
906493013 1:46282684-46282706 CAAAAAAATTTCATAATGGCTGG + Intronic
907106370 1:51886352-51886374 CAGAAAAATCACTTTAACGCAGG + Intergenic
907138399 1:52160708-52160730 TAGAAAAATGTCATCAAGGCCGG - Intronic
907239435 1:53072967-53072989 CAGAAGAATCACATGAACCCGGG + Intronic
907424115 1:54368203-54368225 CAGAAAAATGGCATGAACCCGGG + Intronic
908123876 1:61011246-61011268 CAGAAAAATTACAACAAGCAGGG + Intronic
908204166 1:61828148-61828170 CAGGAAAATCACTTGAAGCCGGG + Intronic
908212102 1:61911304-61911326 CAGAAGAATTACTTGAATCCGGG - Intronic
908234252 1:62134901-62134923 CAGAAAAATTCCAGGAGGGGAGG + Intronic
908285344 1:62591870-62591892 CAGCCAAAATACATGAGGGCAGG + Intronic
908369627 1:63468766-63468788 CAGAAGAATTACTTGAACCCAGG + Intronic
908552184 1:65220566-65220588 CAGAAAAATCACTTGAACCCAGG - Intronic
908829428 1:68164575-68164597 CATAAAAAATACATGAAGTAGGG + Intronic
909194185 1:72594830-72594852 CAGAAGAATTACTTGAACCCAGG + Intergenic
909617979 1:77634075-77634097 CAGGAAAATTACTTGAACCCGGG + Intronic
909682418 1:78307580-78307602 CAGAAAAATCACTTGAACCCTGG - Intronic
910106099 1:83632632-83632654 AAGGAAAATTTCAAGAAGGCAGG + Intergenic
910226506 1:84941402-84941424 CAGAAGAATGGCATGAAGCCGGG + Intronic
910687295 1:89930285-89930307 CAGAAAAATTGCTTGAACCCAGG - Intronic
910719424 1:90269651-90269673 CAGGAAAATTACTTGAACCCAGG + Intergenic
910888106 1:91987940-91987962 CAGAAGAATTGCTTGAAGCCGGG - Intronic
911286335 1:95998127-95998149 CAGGAAAATGACATGAACCCAGG - Intergenic
911350156 1:96744129-96744151 CAGAAAAATTACTTGAACCCGGG + Intronic
911697854 1:100913149-100913171 CAGTAAAATTACATTAAAGCAGG - Intronic
911777627 1:101834793-101834815 CAGACAAATTACATGTTGGATGG + Intronic
912882653 1:113432594-113432616 TAGGAAAATGACTTGAAGGCAGG - Intronic
913256129 1:116955526-116955548 CAGTAAAATGACATGATGTCTGG - Intronic
913291537 1:117277129-117277151 CAGAAAAATCACTTGAACCCGGG + Intergenic
913447193 1:118962012-118962034 CAGAAGAACTACAAGAAGCCAGG + Intronic
913940078 1:125094628-125094650 CAGAAAAATGGCATGAAGCCGGG - Intergenic
914870160 1:151466997-151467019 CAGAAAAATTGCCTGAACCCAGG - Intergenic
914892771 1:151642292-151642314 CAGAAAAATCACTTGAACCCGGG + Intronic
915177620 1:154029595-154029617 CAGGAGAATTACTTGAACGCAGG + Intronic
915314484 1:155020460-155020482 CAGAAGAATCACTTGAACGCGGG - Intronic
915422387 1:155794162-155794184 CAGAAAAATTGCTTGAACTCAGG - Intronic
915501847 1:156324562-156324584 CAGAAAAATTGCTTGAAACCAGG - Intronic
915981492 1:160422996-160423018 CAGGAAAATTACTTGAACCCAGG - Intronic
916372222 1:164111158-164111180 AAGAAAAACTCCATGAGGGCAGG + Intergenic
916490107 1:165294665-165294687 TATAAAAATTACATGCGGGCTGG + Intronic
916540223 1:165746214-165746236 CAGAAGAATTGCTTGAATGCAGG + Intronic
916691724 1:167196213-167196235 CATTAAAATTACATGAAATCAGG + Intergenic
916706787 1:167358779-167358801 CAGAAGAATTACTTGAGGCCAGG - Intronic
917402163 1:174662194-174662216 CAGGAAAATTGCATGAACCCAGG - Intronic
917404562 1:174690922-174690944 CAGAAAAATTCCTTGAACCCAGG - Intronic
917464624 1:175265001-175265023 CAGAGAAGTTACATGAAGTAAGG + Intergenic
917636167 1:176939017-176939039 CAGAAAAATTGCTTGAACCCAGG + Intronic
917800362 1:178563951-178563973 CAGGAAAATTACTTGAACCCAGG + Intergenic
917800871 1:178569031-178569053 CAGAAAAATCACTTGAACTCAGG + Intergenic
918284207 1:183036189-183036211 CAGAAGAATCACTTGAAGCCGGG - Intronic
918317988 1:183339188-183339210 CAGAAGAATGACATGAACCCGGG - Intronic
918331180 1:183462110-183462132 CAGAAGAATTACTTGAATCCGGG - Intergenic
918554914 1:185787264-185787286 GAGAAGAATTAGATTAAGGCTGG + Intronic
919014160 1:192008447-192008469 CAGAAACAGTACAAGAAGGAAGG + Intergenic
919298085 1:195726688-195726710 CAGAAAAATCACTTGAACCCGGG - Intergenic
919617979 1:199831278-199831300 CAGGAGAATTACATGAAGCCAGG + Intergenic
919722627 1:200855687-200855709 CAGAAGAATCACTTGAAGCCAGG - Intronic
919723094 1:200861897-200861919 CAGAAAAATTGCTTGAACCCAGG + Intergenic
920130556 1:203728762-203728784 CAGAAGAATTACTTGAACCCGGG + Intronic
921420435 1:214940916-214940938 CAGAAAAATCACTTGAACCCGGG + Intergenic
921882332 1:220269627-220269649 CAGAAGAATTACTTGAACCCAGG + Intronic
922274679 1:224066335-224066357 CAGAAGAATTACTTGAACCCAGG + Intergenic
922453996 1:225759537-225759559 CAGAAGAATTACTTGAACCCAGG + Intergenic
923113181 1:230909537-230909559 CAGAAAAATTGCTTGAACCCGGG + Intronic
923302243 1:232652022-232652044 CAGAAGAATTACTTGAACCCAGG + Intergenic
923610255 1:235485590-235485612 TAGAAAATTTATTTGAAGGCTGG - Intronic
923718390 1:236446457-236446479 CAGAAGAATCACTTGAACGCAGG + Intronic
923852460 1:237812329-237812351 CATGCAAATTCCATGAAGGCAGG - Intronic
923980529 1:239317327-239317349 ATGAGAAATTACATGAAGGAAGG - Intergenic
924297894 1:242607298-242607320 CAGAAAAATCACTTGAACTCAGG - Intergenic
924311800 1:242751621-242751643 CAGAAGAATTGCTTGAAGCCGGG - Intergenic
924656520 1:245977584-245977606 CAGGAGAATTACATGAACCCAGG + Intronic
924949068 1:248866179-248866201 CAGAAGAATTACTTGAACCCGGG - Intergenic
1062999162 10:1898378-1898400 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1063414349 10:5861343-5861365 CAGAAAAATCACTTGAACCCAGG + Intergenic
1063416802 10:5879860-5879882 TAGAAGAATAACATTAAGGCTGG + Intronic
1063547604 10:6997587-6997609 CAGAAAAATTGCAAGGGGGCCGG + Intergenic
1063726932 10:8647678-8647700 CAGATAAAATACAGGAAGTCTGG - Intergenic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1063998242 10:11641341-11641363 CAGAAAAATCACTTGAACCCGGG - Intergenic
1064068093 10:12200838-12200860 CAGGAGAATTACTTGAACGCAGG + Intronic
1064151658 10:12870773-12870795 CAGAAAAATTGCATGAACCCGGG - Intergenic
1064196785 10:13250263-13250285 CTTAAAAATTACAAGAAGACTGG - Intergenic
1064310898 10:14210818-14210840 CAGAAGAATCACATGAACCCTGG - Intronic
1064474580 10:15673377-15673399 AATAAAAATTACATCATGGCCGG - Intronic
1064679175 10:17792178-17792200 CAGGAAAATTACTTGAACCCAGG - Intronic
1064740767 10:18431855-18431877 CAGAAAAATTGCTTGAACCCAGG - Intronic
1064888358 10:20138614-20138636 CAAAGAAAATACATGAAGGTTGG + Intronic
1064940084 10:20724345-20724367 CAGGAGAATTACATGAATCCAGG + Intergenic
1065087599 10:22195414-22195436 CAGAAAAATTGCATAGATGCTGG - Intergenic
1065345690 10:24745976-24745998 CAGGAGAATGACGTGAAGGCGGG + Intergenic
1065473398 10:26107386-26107408 CAGAAAAATCACTTGAACCCGGG + Intronic
1065473917 10:26113375-26113397 CAGGAAAATTGCTTGAACGCGGG + Intronic
1065510364 10:26472179-26472201 CAGAAAAATTACATGCGGTGTGG - Intronic
1065974818 10:30833178-30833200 CAGAAAAATTCCATGAGTGAGGG - Intronic
1066374924 10:34849253-34849275 ACTAAAAATTAAATGAAGGCTGG - Intergenic
1066392741 10:34991298-34991320 CAGAAAAAATACTTGAGGCCAGG + Intergenic
1066951529 10:42122701-42122723 CAGAAGAATCACTTGAAGCCGGG + Intergenic
1067102733 10:43344610-43344632 CAGGAAAATCACCTGAAGCCAGG + Intergenic
1067122301 10:43483959-43483981 CAGAAGAATCACTTGAAGCCAGG - Intergenic
1067483568 10:46623739-46623761 CAGGAAAATTGCTTGAACGCAGG - Intergenic
1067611187 10:47717903-47717925 CAGGAAAATTGCTTGAACGCAGG + Intergenic
1068247571 10:54392371-54392393 CAGAAAAATCACTTGAACCCAGG + Intronic
1068290630 10:54997014-54997036 CAGAAGAATTGCTTGAAGCCTGG + Intronic
1068331512 10:55577147-55577169 CAGAAAAATTATTTGAACCCAGG + Intronic
1068993369 10:63174604-63174626 CAGACAGATTACCTGAAGTCAGG + Intronic
1069451112 10:68518679-68518701 CAGAAGAATTGCATGAACCCAGG + Intronic
1069453998 10:68539355-68539377 CAGGAAAATTACTTGAACCCGGG + Intergenic
1069518107 10:69095817-69095839 CAGAAAAATTGCTTGAACCCGGG + Intronic
1069666254 10:70162245-70162267 CAGAAGAATTACTTGAACCCAGG + Intronic
1069671396 10:70207894-70207916 TAGAAATATTCCATCAAGGCCGG + Intronic
1070199738 10:74192318-74192340 CAGAAAAATCACTTGAACCCGGG - Intronic
1070316958 10:75322856-75322878 CAAAAAAATTACATGTTGGTTGG - Intergenic
1070584247 10:77749332-77749354 TAGAAAAATTGCAAGAAGGAAGG + Intergenic
1070838340 10:79465724-79465746 AATAAAAATTAAATTAAGGCCGG + Intergenic
1071626606 10:87178141-87178163 CAGGAAAATTGCTTGAACGCAGG + Intronic
1072158008 10:92741335-92741357 GAGAAAAGTTACAAGGAGGCTGG + Intergenic
1072386207 10:94930928-94930950 CAGAAGAATTGCTTGAAGGCAGG + Intergenic
1072500901 10:96016811-96016833 CAGAAAAATCACTAGAACGCGGG - Intronic
1072590971 10:96828265-96828287 CAGGAAAATCACTTGAAGCCGGG - Intergenic
1072597460 10:96887771-96887793 CAGAAGAATTACTTGAACCCAGG - Intronic
1072873531 10:99146766-99146788 CAGGAGAATTACTTGAACGCAGG + Intronic
1072936609 10:99719310-99719332 CAGAAGAATTGCATGAACCCTGG - Intronic
1072950804 10:99845120-99845142 CAGAAAAATCACTTGAACCCAGG - Intronic
1073172329 10:101521038-101521060 CAGGAAAATTGCTTGAAGCCAGG + Intronic
1073338119 10:102726040-102726062 CAGAAAAATTGCTTGAACCCAGG - Intronic
1073603368 10:104868447-104868469 CTGAAAAACTACATGAAGCGTGG - Intronic
1073804231 10:107079131-107079153 CAGGAAAATGACATGAACCCGGG + Intronic
1074196801 10:111196097-111196119 CAGAAGAATGACATGAACCCGGG - Intergenic
1074667102 10:115740596-115740618 CAGAAGAATTGCATGAACCCGGG - Intronic
1075365980 10:121889573-121889595 CAGAAAAATTGCTTGAGGCCAGG + Intronic
1075869498 10:125759533-125759555 CAGGAGAATTACATGAACCCAGG + Intronic
1075892063 10:125960617-125960639 CAGAAGAATGACATGAACCCGGG - Intronic
1076106395 10:127827083-127827105 CAGAACATTTCCATCAAGGCTGG + Intergenic
1077395605 11:2319438-2319460 CAGAAGAATCACTTGAAGTCAGG + Intergenic
1077471834 11:2767073-2767095 CAGAAAAATCACTTGAACCCGGG + Intronic
1077645526 11:3920186-3920208 CAGAAAGACTGCTTGAAGGCAGG - Intronic
1077947341 11:6915142-6915164 CAGAAAAATCACTTGAACCCAGG - Intergenic
1078310687 11:10238109-10238131 CAAAAATATAACATGGAGGCTGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078767182 11:14309779-14309801 CAGAAAATTAACAGGGAGGCAGG + Intronic
1078969981 11:16398033-16398055 CAGAAAATTGCCATGAAGCCTGG - Intronic
1079068902 11:17325705-17325727 CAGAAAAATAACAAAATGGCAGG - Intronic
1079123965 11:17705622-17705644 CAGAAAAATTTCCTGAGGACAGG + Intergenic
1079845870 11:25466860-25466882 CAGAAGAATTACTTGAACCCAGG + Intergenic
1080329053 11:31114425-31114447 GAGAAAAAATACATCAGGGCAGG + Intronic
1080469352 11:32530007-32530029 CAGGAAAATTACTTGAACCCGGG + Intergenic
1080483315 11:32676474-32676496 CAGAAAAATTACTTGAATTTTGG - Intronic
1080766182 11:35299244-35299266 CAGAAAAATCACTTGAACCCGGG + Intronic
1081131362 11:39384038-39384060 CAGAAAAATCACTTGAACCCAGG + Intergenic
1081159120 11:39732193-39732215 CAGGAAAGTTACATTCAGGCAGG - Intergenic
1081479193 11:43468705-43468727 CAGAAGGATTACTTGAAGCCAGG + Intronic
1081680119 11:44996427-44996449 CAGAAGAATCACATGAACCCAGG + Intergenic
1081908676 11:46686062-46686084 CAGAAGAATTACTTGAACCCGGG - Intronic
1081913506 11:46716481-46716503 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1081954695 11:47080579-47080601 AGGAAAAATTACATGATTGCAGG + Intronic
1082002144 11:47399116-47399138 CAGCAAAATTACTTGAACCCGGG - Intergenic
1082049074 11:47755354-47755376 CAGAAAAATTGCTTGAACTCGGG + Intronic
1082918795 11:58469237-58469259 CAGAAGAACTGCTTGAAGGCAGG + Intergenic
1083374978 11:62212540-62212562 CAGAAGAATTACTTGAAGCCAGG + Intronic
1083559259 11:63659397-63659419 CAGAAAGATTACTTGAGGCCAGG + Intronic
1084663802 11:70564554-70564576 GAGAAAAAATACTTGAAGGCTGG - Intronic
1084733914 11:71092303-71092325 CAAACAAAATACCTGAAGGCAGG + Intronic
1084759343 11:71259066-71259088 CAGAAGAATCACATGAACCCAGG - Intergenic
1085028557 11:73255675-73255697 CAGAAAAATTGCTTGAACCCGGG - Intergenic
1085551414 11:77376642-77376664 CAGAAGAATTGCATGAACCCAGG + Intronic
1085655321 11:78309407-78309429 TCTTAAAATTACATGAAGGCTGG - Intronic
1086369699 11:86144129-86144151 CAGAAAAATCACTTGAACCCAGG - Intergenic
1086869626 11:92021351-92021373 AAGATAAATTACATGGGGGCGGG - Intergenic
1087329354 11:96760293-96760315 ATTAAAAATTACTTGAAGGCAGG + Intergenic
1087644721 11:100795017-100795039 AAGAAACATTACAAGAAAGCTGG - Intronic
1087650740 11:100864275-100864297 CAGGAGAATCACATGAAGCCGGG - Intronic
1087744684 11:101930010-101930032 CAGAAAAAAAACTTGAAGCCTGG - Intronic
1087854131 11:103070370-103070392 CAGAAATATTAAAAGAAAGCAGG + Intronic
1087864462 11:103207012-103207034 CAGAAGAATCGCATGAAGCCAGG - Intronic
1088032726 11:105271008-105271030 CAGAAAAATTAGATGACGTTGGG - Intergenic
1088702396 11:112425079-112425101 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1089334404 11:117713206-117713228 CAGGAGAATTGCTTGAAGGCAGG - Intronic
1089676577 11:120094170-120094192 CAGAAAAATTCCTTGAACCCGGG + Intergenic
1090171653 11:124611169-124611191 CACACAAATTACATGGAGGGGGG + Intergenic
1090220706 11:125021251-125021273 CAGAAAAGTTTCAGGAAGGAGGG + Intronic
1090538887 11:127678562-127678584 CATCAATATTACATGAAGGCTGG - Intergenic
1090909480 11:131105911-131105933 CAGAAGAATCACATGAACCCGGG + Intergenic
1091019418 11:132086229-132086251 CAGGAAAATGACATGAACCCAGG + Intronic
1091367638 11:135035798-135035820 CAGAAAAATTATTTAAAGGAAGG + Intergenic
1091422802 12:357733-357755 CAGAAGAATTACTTGAACCCAGG + Intronic
1091428271 12:410636-410658 CAGAATAATTGCTTGAACGCAGG - Intronic
1092900700 12:13057068-13057090 CACAAAAATCACCTGAACGCGGG - Intronic
1092961462 12:13600258-13600280 CACAAAAATGAAATGAAGGAAGG - Intronic
1093682755 12:22021832-22021854 CAGAGAAATTACATCAAGTTTGG - Intergenic
1094123045 12:26994374-26994396 CATAAAAATCACCTGAGGGCTGG + Intronic
1094369577 12:29722826-29722848 CAGAAGAATTACTTGAACCCGGG + Intronic
1094592828 12:31837516-31837538 CAGAAGAATCACTTGAACGCGGG - Intergenic
1095588248 12:43872127-43872149 CAGGAATATTACTTGAAGCCAGG - Intronic
1095603388 12:44038996-44039018 CAGTAAAATTATATGATGTCTGG - Intronic
1095615070 12:44179099-44179121 CAGAAAAATCACTTGAACCCGGG + Intronic
1095787516 12:46126230-46126252 TAGAACAATTACCTGAGGGCAGG - Intergenic
1096187346 12:49589886-49589908 CAGGAAAATTGCTTGAACGCAGG + Intronic
1096467276 12:51853635-51853657 CAGAAGAATTACTTGAACCCCGG + Intergenic
1096802197 12:54117988-54118010 CAGGAAAATCACTTGAAGCCTGG + Intergenic
1097075271 12:56388382-56388404 CAGGAAAATTGCTTGAAGCCGGG + Intergenic
1097157512 12:57023616-57023638 CAGAAGAATTGCATGAACCCGGG - Intronic
1097683476 12:62670763-62670785 CATACAAATTACATGAAGAACGG - Intronic
1097867115 12:64568122-64568144 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1097899964 12:64862810-64862832 AAAAAAAATTACATGAATGAGGG + Intronic
1097914466 12:65005834-65005856 AATATAAATTCCATGAAGGCAGG + Intergenic
1098690141 12:73477101-73477123 CCAAAAAAATACATGAAGTCAGG - Intergenic
1098775861 12:74616293-74616315 CAAGAAAATTACATGATGGATGG - Intergenic
1099064679 12:77959657-77959679 CAAAAAAATTCCATGATGGTGGG - Intronic
1099084522 12:78228704-78228726 CGGAAGAATTACATGAGGCCAGG - Intergenic
1099350836 12:81566429-81566451 CAGAAGAATCACTTGAAGCCGGG + Intronic
1099567057 12:84264723-84264745 CAGGAGAATTACATGAATCCAGG + Intergenic
1100034577 12:90235146-90235168 CAGGAGAATTACATGAGGCCAGG - Intergenic
1100076384 12:90789645-90789667 CAGAAGAATTACGTGAATCCAGG + Intergenic
1100077386 12:90802393-90802415 CAGAAAAATCACTTGAACCCAGG - Intergenic
1100125615 12:91421093-91421115 CAGAAGAATTACTTGAACCCAGG + Intergenic
1100248733 12:92792315-92792337 CAAAAAAATTCAATGAATGCAGG + Intronic
1100251854 12:92834314-92834336 CAGAAAGATTACTTGAGGTCAGG + Intronic
1100321155 12:93494200-93494222 CAGAAAAATTACAAGAACCAAGG + Intronic
1100772031 12:97934334-97934356 CAGAAGAATTACTTGAACCCGGG - Intergenic
1101118756 12:101557103-101557125 CACAAAAATTACTTGAACCCAGG + Intergenic
1101181823 12:102227075-102227097 CAGAAAAGTTACAGGAATGTAGG + Intergenic
1101690342 12:107073634-107073656 CAGAAGAATTGCATGAACCCGGG + Intronic
1101714395 12:107297878-107297900 CAGGAAAATTGCATGAACCCAGG - Intergenic
1101918427 12:108913739-108913761 CAGAAAAATTGCTTGAACCCGGG - Intronic
1102231188 12:111263530-111263552 CAGAAGAATTACTTGAACCCAGG + Intronic
1102393160 12:112566046-112566068 CAGAAGAATTACTTGAACCCAGG - Intergenic
1102473459 12:113173715-113173737 CAGGAAAATAACAGGATGGCAGG + Intronic
1102918760 12:116775948-116775970 CAGAAGAATTGCTTGAAGCCAGG + Intronic
1102923209 12:116808384-116808406 CAGCAACAAAACATGAAGGCTGG - Intronic
1103296280 12:119889848-119889870 CAGGAGGATTACATGAAGCCAGG - Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104503617 12:129310032-129310054 CAGAAAATCTAGATGAGGGCTGG + Intronic
1104553168 12:129776079-129776101 CCGAATAATTCCAGGAAGGCTGG + Intronic
1104701371 12:130906984-130907006 CAGAAGGATTACTTGAAGTCAGG - Intergenic
1105027962 12:132862180-132862202 CAGAAAAATTGCTTGAACCCGGG + Intronic
1105034740 12:132910355-132910377 CAGAAGAATCACTTGAACGCGGG - Intronic
1105266249 13:18819855-18819877 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1105268566 13:18847247-18847269 CAGAAGAATTACTTGAACCCAGG - Intergenic
1105320465 13:19315166-19315188 TAAAAAAATTACCTGTAGGCTGG - Intergenic
1105389684 13:19963132-19963154 TAAAAAAATCACATGCAGGCCGG - Intronic
1105471275 13:20697181-20697203 CAGAAGGATTGCTTGAAGGCAGG + Intergenic
1105773366 13:23633754-23633776 CAGAAGAATCACTTGAACGCGGG + Intronic
1105803047 13:23926601-23926623 CAGGAAAATTACTTGAACCCGGG + Intergenic
1105953435 13:25255614-25255636 CAGAAGAATTACTTGAACCCAGG - Intronic
1106144678 13:27040372-27040394 CAGAAAAATTGCTTGAACCCGGG + Intergenic
1106290945 13:28361184-28361206 CAGAAGAATTGCTTGAAGCCGGG + Intronic
1106320124 13:28629978-28630000 CAGAAGAATTACTTGAACCCGGG - Intergenic
1106505455 13:30367425-30367447 TAGAAAAAGTACATCAAGGCCGG + Intergenic
1106751307 13:32771654-32771676 TAGAAAAATTACATGGAAGATGG - Intronic
1107096354 13:36541178-36541200 GTGAAAAGTTACATGAAGGGAGG + Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107857336 13:44629206-44629228 CAGAAGAATCACTTGAATGCAGG - Intergenic
1107910778 13:45103960-45103982 CAGAAGAATCACATGAATCCAGG - Intergenic
1107932744 13:45319685-45319707 CAGAAGAATTGCATGAACCCGGG + Intergenic
1108139093 13:47399404-47399426 CAGAAAAATCACTTGAACCCAGG + Intergenic
1108186778 13:47895852-47895874 CAGGGAGAATACATGAAGGCTGG + Intergenic
1108651551 13:52485312-52485334 CAGAAAAATTGCTTGAACTCGGG + Intergenic
1108680679 13:52777689-52777711 CAGAAGAATGACATGAACCCGGG + Intergenic
1108742169 13:53349573-53349595 CAGAAAAATAACATGGAAGGAGG - Intergenic
1109064908 13:57674552-57674574 CGGAAGAATTACTTGAAGCCAGG - Intronic
1109143392 13:58745509-58745531 CAGAAAAATCACTTGAACCCAGG - Intergenic
1110143303 13:72158087-72158109 CAGAAGAATAACATCAAGTCAGG + Intergenic
1110284063 13:73729435-73729457 CAGAAAAAGTACTTGACAGCAGG + Intronic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1110713642 13:78677094-78677116 CATAAGAATCACATGAAGACCGG - Intergenic
1110915322 13:81014072-81014094 CAGGAAAATTACTTGAACCCAGG - Intergenic
1111377327 13:87397697-87397719 CAAAAATATTTCATGAAGGCAGG + Intergenic
1111446377 13:88349640-88349662 CAGGAGAATGGCATGAAGGCGGG + Intergenic
1111737291 13:92158793-92158815 TAAAAAGATTACATGATGGCTGG - Intronic
1111877749 13:93918002-93918024 CAGAAAAATCACTTGAACCCGGG + Intronic
1111890936 13:94081931-94081953 CAGAAAAATTGCTTGAATCCGGG - Intronic
1112195599 13:97223254-97223276 CAGAATAATTTAATGAGGGCAGG + Intronic
1112346558 13:98594876-98594898 CAGAAGAATCACATGAACCCAGG + Intergenic
1112843957 13:103614599-103614621 CAGAAGAATTACTTGAACCCGGG + Intergenic
1112973941 13:105293994-105294016 CAGAAAATTTAAGTGAAGGGTGG - Intergenic
1112999115 13:105611584-105611606 CAGAAACATGACAAGAATGCAGG - Intergenic
1114238104 14:20840142-20840164 CAGTAATAAAACATGAAGGCCGG - Intergenic
1114238841 14:20847430-20847452 CAGGAGAATTACTTGAAGCCTGG - Intergenic
1114511710 14:23267519-23267541 CACAAAAATCACTTGAAGCCAGG - Intronic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114919614 14:27310550-27310572 CAAAAAAATTAATTGAATGCCGG + Intergenic
1115001085 14:28420539-28420561 CAGTAAACTATCATGAAGGCAGG + Intergenic
1115103507 14:29732416-29732438 TAGAAAAATAGCATAAAGGCAGG - Intronic
1115601010 14:34956027-34956049 CAGAAGAATTACTTGAACCCGGG + Intergenic
1115998006 14:39213633-39213655 CAGAAAAAAGACATAGAGGCTGG + Intergenic
1116102365 14:40456415-40456437 CAGAAGAATTGCTTGAACGCGGG + Intergenic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1116511126 14:45747905-45747927 CAGAAGAATTGCATGAACCCAGG + Intergenic
1116925848 14:50636001-50636023 TAGAAGAATTATATGTAGGCCGG - Intronic
1117137983 14:52756778-52756800 CAGAAAAATCACTTGAACCCGGG - Intronic
1117355296 14:54918202-54918224 CAGAAATATCACATGAGGCCGGG - Intergenic
1117356479 14:54928612-54928634 CAGGAGAATTACTTGAAGCCAGG + Intergenic
1117373735 14:55102149-55102171 CAGAAAAATTACAAGAACAATGG - Intergenic
1117419359 14:55528889-55528911 CTGAAAAATCACATGAAGATTGG - Intergenic
1117714868 14:58570331-58570353 TAAAAATATTAAATGAAGGCCGG - Intergenic
1117858755 14:60066043-60066065 CAGGAGGATTACATGAAGCCAGG - Intergenic
1117914678 14:60664621-60664643 CAGAAAAATCACATGAGCCCGGG + Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118191257 14:63582699-63582721 CAGGAAGATTACTTGAAGCCTGG + Intergenic
1118476430 14:66121525-66121547 CAGAAGAATTGCATGAACCCGGG + Intergenic
1118601892 14:67476492-67476514 CAGAAAAATTGCTTGAACCCAGG + Intronic
1118694532 14:68371423-68371445 CAGAAGAATTGCTTGAACGCGGG + Intronic
1118824989 14:69371849-69371871 CAGAAGAATTGCTTGAAGCCGGG + Intergenic
1118880096 14:69818438-69818460 AAGAAAAATTACAAGAAAGTTGG + Intergenic
1118900931 14:69984947-69984969 CAGAAGAATTACTTGAACCCAGG + Intronic
1119221659 14:72913281-72913303 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1119805715 14:77480853-77480875 CAGAAAATTTTCATGACAGCCGG - Intronic
1120172640 14:81261073-81261095 CATAAAAGTTAAATGAATGCTGG + Exonic
1120226787 14:81799661-81799683 CAGAAATCTTACATGGGGGCAGG - Intergenic
1120302181 14:82721840-82721862 CAGAAAGATTACTTGAGGTCAGG + Intergenic
1120535866 14:85694020-85694042 CTGAAAAATTACATGAGAACAGG + Intergenic
1120756633 14:88250796-88250818 CAGAAAAATCACTTGAATACAGG + Intronic
1120879173 14:89401347-89401369 CAGAAGAATCACTTGAAGCCAGG + Intronic
1120964419 14:90155092-90155114 TAGAAAAATTACAGTAAAGCAGG + Intronic
1121186707 14:91978724-91978746 CAGGAGAATTACTTGAACGCAGG - Intronic
1121335430 14:93075027-93075049 CAGAAAAATTCAATGCAGGTTGG + Intronic
1121346735 14:93141662-93141684 CAGAAGAATTGCATGAACCCAGG - Intergenic
1121931873 14:97979597-97979619 AAGAAAAAATAAATGAAGGAAGG - Intergenic
1122148065 14:99705830-99705852 CAGAAAAATTGCTTGAACCCAGG + Intronic
1122474946 14:102001047-102001069 CTGAAAGGTTACATGAAGGTAGG + Exonic
1122598219 14:102907984-102908006 CAGGAAAACTACCTGAGGGCAGG - Exonic
1122701060 14:103589514-103589536 CAGAAGAATTACTTGAACCCAGG + Intronic
1122807197 14:104265764-104265786 CAGGAAAATTGCTTGAAGGTGGG + Intergenic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1202937181 14_KI270725v1_random:101044-101066 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1123390138 15:19862754-19862776 CAGAAAAATCACTTGAAACCGGG + Intergenic
1123396026 15:19936832-19936854 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1123495967 15:20827229-20827251 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1123552455 15:21396321-21396343 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1123588698 15:21833718-21833740 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1123851607 15:24362666-24362688 CAGAAGAATTACTTGAACCCGGG - Intergenic
1123912717 15:24984523-24984545 CAGACAAATAAAATCAAGGCTGG - Intergenic
1124023717 15:25945770-25945792 GAGAAAAATTAAAGGATGGCAGG + Intergenic
1124444005 15:29712636-29712658 CAGTTAAAGTACATGAAGGATGG - Intronic
1124451574 15:29797375-29797397 CAGACAAATTACTTGAGGCCAGG - Intronic
1124573622 15:30888140-30888162 TAGAAAAATAATTTGAAGGCTGG + Intergenic
1124642575 15:31405219-31405241 CAGGAGAATTGCATGAAGCCGGG + Intronic
1125043192 15:35215614-35215636 CAGGAAGATTACTTGAAGCCAGG - Intergenic
1125437114 15:39658340-39658362 CAGAAGAATTACTTGAACCCAGG - Intronic
1125474161 15:40033933-40033955 CAGAAGAATTACTTGAACCCAGG + Intronic
1125652150 15:41326067-41326089 CAGAAGAATTGCTTGAAGCCAGG + Intronic
1125713861 15:41807944-41807966 CAGAAGAATTGCTTGAACGCGGG + Intronic
1125737606 15:41938433-41938455 CAGTAATAGTACATGAAGCCGGG - Intronic
1125750990 15:42028497-42028519 CAGGAAAATTGCTTGAAGCCAGG - Intronic
1126004626 15:44244385-44244407 CAGAAAAGTGACCTGTAGGCTGG - Intergenic
1126170230 15:45689508-45689530 CAGGAAAATTGCATGAACCCAGG - Intronic
1126192011 15:45887788-45887810 CAGAAAAATCACTTGAACCCGGG - Intergenic
1126601700 15:50434707-50434729 CAGAAAAATCACTTGAACCCAGG - Intronic
1126787347 15:52187854-52187876 CAGGAGAATTACTTGAAGCCGGG + Intronic
1127091659 15:55472936-55472958 CAGGCAAATTACTTGAAGTCAGG + Intronic
1127129759 15:55850092-55850114 TAGAAAAATTACCTAAAGGCCGG - Intronic
1127481815 15:59384832-59384854 GAGGAAAATTAGATGAAGACTGG - Intronic
1127543344 15:59965315-59965337 CAGGAAAATGACATGAACCCGGG + Intergenic
1127597845 15:60504452-60504474 CAGAAGAATTACTTGAACCCGGG + Intronic
1127620634 15:60730448-60730470 CAGAAATAATACATGCTGGCTGG + Intronic
1128000625 15:64188080-64188102 CATAAAAATAACATCAAGGTAGG - Intronic
1128196726 15:65764268-65764290 CAGAAAAATCACTTGAGGCCAGG + Intronic
1128422487 15:67507154-67507176 CAGAAGAATCACATGAACCCAGG - Intergenic
1129041278 15:72688504-72688526 CAGAAAAATCACTTGAACCCGGG - Intronic
1129047048 15:72744828-72744850 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1129096093 15:73209908-73209930 CAGGAAAATCACATGAACCCAGG + Intronic
1129287013 15:74533684-74533706 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1129443817 15:75602113-75602135 CAGGAAAATGACATGAACCCGGG + Intronic
1129571647 15:76692390-76692412 TAGAAAAATAACATGAAGGCTGG + Intronic
1129855682 15:78823057-78823079 CAGAAAAATCACTTGAACTCGGG + Intronic
1129947761 15:79556102-79556124 CAGAAAAAGGACATGAATCCAGG - Intergenic
1130604615 15:85304485-85304507 CAGGAGAATTACTTGAAGGGAGG + Intergenic
1130719195 15:86370395-86370417 CAGAAAAATCACTTGAACCCGGG - Intronic
1130832497 15:87615801-87615823 CAGAAGAATTGCTTGAAGCCGGG + Intergenic
1130954728 15:88619593-88619615 CAGGAAAATTACTTGAACCCGGG + Intergenic
1131836974 15:96400632-96400654 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1131979869 15:97984564-97984586 CAGAAGAATTACTTGAACCCGGG + Intergenic
1132116548 15:99140460-99140482 CAGGAAAATCACATGAACCCAGG - Intronic
1202960801 15_KI270727v1_random:123552-123574 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1133257728 16:4527907-4527929 CAGAAGAATTACTTGAACCCGGG - Intronic
1133629907 16:7610210-7610232 CAGAAGAATTGCATGAACCCGGG - Intronic
1133802773 16:9097531-9097553 CAGAAAAACTACACACAGGCTGG - Intronic
1133827490 16:9291399-9291421 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1134197987 16:12173870-12173892 CAGGAAAATTGCTTGAAGCCGGG - Intronic
1134235409 16:12461405-12461427 CTGCAAAATTCCATGCAGGCAGG - Intronic
1134272479 16:12745187-12745209 CAGAAAAAATACGTGAAGAAAGG + Intronic
1134759900 16:16705086-16705108 TAGAAAAATGAAATGCAGGCTGG + Intergenic
1134792484 16:17001864-17001886 CAGAAAAATCACTTGAACCCAGG - Intergenic
1134816488 16:17210201-17210223 TAGAAAAATTATCTGTAGGCTGG + Intronic
1134863271 16:17580216-17580238 AAGACAAATTATATGTAGGCAGG + Intergenic
1134986172 16:18654119-18654141 TAGAAAAATGAAATGCAGGCTGG - Intergenic
1135024745 16:18990385-18990407 CACAAAAATTGCTTGAACGCAGG - Intronic
1135348882 16:21712232-21712254 CAGAAGAATTACTTGAACCCAGG + Intronic
1135433002 16:22402804-22402826 CAAAAATATCACATGTAGGCAGG + Intronic
1135639141 16:24105147-24105169 CAGAAAAATCACTTGAATCCAGG - Intronic
1136184152 16:28575590-28575612 CAGGAAAATTGCTTGAAGCCGGG + Intronic
1136698491 16:32108973-32108995 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1136769107 16:32818858-32818880 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1136798995 16:33052270-33052292 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1136850801 16:33610862-33610884 CAGAAGAATTACTTGAACCCAGG - Intergenic
1136956683 16:34795223-34795245 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1137069733 16:35893212-35893234 CAGAAAAAGTAACTAAAGGCCGG + Intergenic
1137758726 16:50923350-50923372 CAGGAAAATTAAATGAACACTGG + Intergenic
1138442414 16:57042936-57042958 CAGGCAAATTACATGAAGACTGG + Intronic
1138513862 16:57525186-57525208 CAGGAAAATTGCTTGAAGCCGGG - Intronic
1138540981 16:57687341-57687363 CAGAAGAATTACTTGAACCCAGG - Intronic
1138910254 16:61388052-61388074 CAGAAGAATCATTTGAAGGCAGG - Intergenic
1138912021 16:61412457-61412479 AAGAAAAGTTACATGAATGGAGG - Intergenic
1138953664 16:61944712-61944734 CAGAAGAATTACTTGAGGCCAGG + Intronic
1139086468 16:63592388-63592410 CAGGAAAATCACTTGAACGCGGG + Intergenic
1139394502 16:66629812-66629834 CAGAAAAAATACCTGAACGATGG + Intronic
1139509396 16:67418121-67418143 CAGGAAAATCACTTGAAGCCAGG + Intergenic
1139791561 16:69441244-69441266 CAGGAAAATCACTTGAACGCGGG - Intronic
1140121575 16:72087910-72087932 CAGAAAAATGGCATGAACCCAGG - Intronic
1140159987 16:72479732-72479754 CAGGAAAATCACTTGAAGCCAGG + Intergenic
1140302493 16:73771982-73772004 CACAAAAATGATATGAAGGTTGG - Intergenic
1140392641 16:74600637-74600659 CAGAAAAATCACTTGAACCCAGG + Intronic
1140496540 16:75393960-75393982 CAGAAGAATGACATGAACCCGGG + Intronic
1140627246 16:76808979-76809001 CAGCAAAATTAGATGAATTCTGG - Intergenic
1140757375 16:78079956-78079978 CAGAAAGATCACTTGAAGCCAGG + Intergenic
1140766717 16:78166649-78166671 CAGAAGAATTGCTTGAACGCAGG - Intronic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141065054 16:80907602-80907624 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1141458190 16:84158820-84158842 CAGAAAAATCACTTGAACCCAGG - Intronic
1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG + Intergenic
1141941616 16:87279743-87279765 CAGGAAAATTGCTTGAACGCAGG - Intronic
1141958140 16:87385916-87385938 CAGAAGAATTACTTGAACCCGGG + Intronic
1203071526 16_KI270728v1_random:1080965-1080987 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1203112408 16_KI270728v1_random:1459317-1459339 CAGAAGAATTACTTGAACCCAGG - Intergenic
1142579164 17:930339-930361 CAGAAGAATCACTTGAAGCCGGG + Intronic
1143692124 17:8577622-8577644 CACAAAAATTCCTTGAAGCCGGG - Intronic
1144478504 17:15609951-15609973 CAGAAAAATCACTTGAACCCAGG - Intronic
1144561174 17:16321331-16321353 CAGAAAAATCACTTGAACCCAGG - Intronic
1145229880 17:21165821-21165843 CAGAAGAATTACTTGAACCCAGG + Intronic
1145235389 17:21204339-21204361 CAGAAGAATTGCTTGAACGCAGG + Intronic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1146015182 17:29227495-29227517 CAAAAAAAGTACATGTAGGCCGG - Intergenic
1146041637 17:29460282-29460304 CAGAAGAATTGCATGAACCCGGG - Intronic
1146082339 17:29792013-29792035 CAGAAAAATCACTTGAACCCAGG - Intronic
1146189571 17:30753014-30753036 CAGGAGAATTACATGAACTCAGG - Intergenic
1146304562 17:31721074-31721096 CAGAAGAATTACTTGAACCCGGG + Intergenic
1146334463 17:31957330-31957352 CAGGAGAATTACATGAACTCAGG - Intronic
1146366130 17:32229752-32229774 CAGGAGAATCACATGAAGCCGGG - Intronic
1146511819 17:33456081-33456103 CAGAAAAACTAAATGAGAGCTGG - Intronic
1146988606 17:37246227-37246249 CAGAGAAAATACATGGAGGTGGG - Intronic
1146991922 17:37281771-37281793 CAGAAGAATTGCATGAACCCAGG + Intronic
1147046574 17:37756614-37756636 CAGAAGAATTACTTGAACCCAGG - Intergenic
1147294824 17:39473790-39473812 CAGAAGAATTACTTGAACCCAGG + Intronic
1147501529 17:40968883-40968905 CAGAAGAATTACTTGAACCCAGG + Intergenic
1147576422 17:41602417-41602439 CAGAAGAATTTCTTGAGGGCAGG - Intergenic
1147601692 17:41750371-41750393 CAGAAGAATTACTTGAACCCAGG - Intergenic
1148357839 17:46987873-46987895 CAGAAACATTACGTTAAGTCCGG + Intronic
1148646259 17:49221172-49221194 CAAAAAAATAAAATAAAGGCCGG + Intronic
1148892153 17:50816091-50816113 CAGAAGAATTGCTTGAAGCCAGG - Intergenic
1148946948 17:51271224-51271246 CAGAAACAATACTTGAAGACAGG - Intronic
1149030047 17:52072359-52072381 CACCAAAAATCCATGAAGGCTGG - Exonic
1149718275 17:58816318-58816340 TAGAAATATTACATACAGGCTGG - Intronic
1149754472 17:59175647-59175669 CACAAGAATTACATGAACCCAGG + Intronic
1149783141 17:59414002-59414024 ATGAAAAAGTACATGTAGGCTGG - Intergenic
1149834701 17:59902195-59902217 CAGGAAAATTACTTGAACCCAGG - Intronic
1150096998 17:62385810-62385832 CAGAAGAATGACATGAACCCAGG - Intronic
1150822061 17:68443201-68443223 CAGGAAAATTACTTGAACCCAGG - Intronic
1151639695 17:75382128-75382150 CAGAAAAATCACTTGAACTCGGG + Intronic
1151760549 17:76099801-76099823 CACAAAAATATGATGAAGGCAGG + Intronic
1151841618 17:76622455-76622477 CAGAAGAATTACTTGAACCCGGG - Intergenic
1152930882 17:83109326-83109348 CAGGAAAATTACATGTGGACTGG + Intergenic
1153254915 18:3160953-3160975 TAGAAAAAGTTCATGAAGGAAGG + Intronic
1153264858 18:3260377-3260399 CAGAAGAATCACATGAACCCGGG + Intergenic
1154422167 18:14241616-14241638 CAGAAAGATTACTTGAGGCCAGG - Intergenic
1154453372 18:14499730-14499752 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1154518875 18:15204875-15204897 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1155025632 18:21937931-21937953 CAGAAGAATTACTTGAACCCGGG + Intergenic
1155031484 18:21988746-21988768 CAGAATAATTGCTTGAAGCCGGG + Intergenic
1155118529 18:22794731-22794753 TATAAAAATTAAATCAAGGCCGG + Intergenic
1155192024 18:23438677-23438699 CAGAAAAATTACATAAGGGTTGG - Intergenic
1156327800 18:36090005-36090027 CAGAAGAATCACTTGAAGCCCGG + Intergenic
1156827743 18:41452183-41452205 CAGAAGAATTGCTTGAAGCCAGG + Intergenic
1157256726 18:46146067-46146089 CAGAAAAATCACCTGAACCCAGG + Intergenic
1157273251 18:46292846-46292868 AAGAAAAATAACACCAAGGCCGG - Intergenic
1157343067 18:46796862-46796884 CAGAAAAACTGAATGCAGGCTGG - Intergenic
1157494305 18:48144184-48144206 CAGAAGAATCACTTGAAGCCGGG + Intronic
1157903038 18:51539359-51539381 CAGGAGAATTACATGAACCCAGG - Intergenic
1158227903 18:55219429-55219451 CACAATAATTACCTGAAGGTAGG - Intergenic
1158294246 18:55977305-55977327 CAGAAGAATTACTTGAACCCAGG - Intergenic
1158556326 18:58477683-58477705 CAGCAAAATTGCTTGAATGCGGG - Intergenic
1159068513 18:63595601-63595623 TAAAAAAATTATGTGAAGGCCGG + Intronic
1159874612 18:73796395-73796417 CAGGAGAATGGCATGAAGGCGGG + Intergenic
1159936079 18:74368651-74368673 CAGGAAAATTGCTTGAAGCCGGG + Intergenic
1160022725 18:75192885-75192907 CAGAAAAAGCACATCAAGCCTGG + Intergenic
1160201938 18:76802840-76802862 CAGGAGAATTACATGAACCCGGG + Intronic
1161525297 19:4751018-4751040 CAGAAGAATTGCTTGAAGGCAGG - Intergenic
1161544773 19:4873734-4873756 CAGAAGAATTACTTGAAGCCAGG + Intergenic
1161615178 19:5266164-5266186 CAGAAAAATCACTTGAACCCGGG + Intronic
1161740456 19:6018066-6018088 CAGAAGAATCACTTGAAGCCTGG - Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161789216 19:6348961-6348983 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1162188557 19:8926725-8926747 CAGGAAAATTGCATGAACCCGGG + Intronic
1162272052 19:9624186-9624208 CAGGCAAATTACCTGAAGTCGGG + Intronic
1162298763 19:9831669-9831691 CAAAAAAATCACATGAACCCAGG - Intergenic
1162400837 19:10445673-10445695 CAGAAAAATCACTTGAATCCGGG + Intronic
1162480161 19:10923008-10923030 CAGAGAATTTATATAAAGGCGGG - Exonic
1162510728 19:11116630-11116652 CAGAAAAACTTCAAGGAGGCTGG - Intronic
1162807010 19:13142874-13142896 CAGGAAAATCACTTGAATGCGGG + Intergenic
1163029648 19:14536021-14536043 CAGAAAAATTATCTCAAGCCTGG - Intronic
1163108995 19:15146441-15146463 CAGAAGAATTACTTGAACCCAGG + Intergenic
1163486328 19:17588797-17588819 CAGGAAAATCACCTGAAGTCAGG - Intergenic
1163873248 19:19843238-19843260 CAGAAGAATCACATGAACCCAGG + Intergenic
1163983732 19:20925362-20925384 CAGAAGAATTACTTGAACCCGGG + Intronic
1164098097 19:22029806-22029828 CAGAAGAATTACTTGAACCCAGG + Intergenic
1164136035 19:22417134-22417156 CAGAAGAATTACTTGAACCCAGG + Intronic
1164190429 19:22911799-22911821 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1164301896 19:23970020-23970042 CAGAAGAATTACTTGAACCCAGG - Intergenic
1164991211 19:32685543-32685565 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1165548199 19:36560162-36560184 CAGAACAATCACATGAACCCAGG + Intronic
1165663890 19:37608988-37609010 CAGATAAGTTAAATGAAAGCTGG - Intronic
1166164560 19:40978139-40978161 CGGGAAAATCACATGAGGGCAGG + Intergenic
1166174009 19:41052693-41052715 CAGAAAAATCACTTGAACCCGGG - Intergenic
1166188036 19:41154833-41154855 CAGGAAAATGACATGAACCCGGG + Intergenic
1166316214 19:41991640-41991662 CAGAAACCTTAGTTGAAGGCTGG + Intronic
1166394590 19:42429622-42429644 CATAAAAATTAAATGTTGGCTGG - Intronic
1166482518 19:43186067-43186089 CAGGAAAATCACATGAACCCGGG - Intronic
1166815947 19:45545803-45545825 CAGAAGAATTACTTGAACCCAGG - Intronic
1167068178 19:47202815-47202837 CAGGAAAATGACATGAATCCGGG + Intronic
1167161206 19:47768387-47768409 CAGAAGAATTACTTGAACCCGGG + Intergenic
1167212889 19:48144592-48144614 CAGAAGAATCACTTGAAGCCAGG - Intronic
1167247398 19:48382072-48382094 CAGGAAAATTGCATGAACCCAGG - Intergenic
1167345617 19:48943900-48943922 CAGAAAAATCACTTGAACCCAGG + Intronic
1167553110 19:50174673-50174695 GAGAAAAATAACAAGAATGCAGG + Intergenic
1167807541 19:51799012-51799034 CAGAAGAATTACTTGAACCCAGG + Intronic
1167852761 19:52214462-52214484 AATAAAAATTCCATGAGGGCAGG + Intronic
1168304134 19:55425416-55425438 CAGGAGAATTACCTGAAGTCAGG + Intergenic
1168478919 19:56700712-56700734 CAGGAAAATCACTTGAAGTCGGG - Intergenic
1168604003 19:57743647-57743669 CAGAAGAATTACTTGAACCCGGG - Intronic
1202682654 1_KI270712v1_random:22157-22179 CAGAAAAATGGCATGAAGACGGG + Intergenic
925310600 2:2878945-2878967 CAGAGAAATTCCAGGAAGACAGG - Intergenic
925465081 2:4100132-4100154 CAGGAAAATTACCTGAACCCGGG - Intergenic
925741681 2:7010379-7010401 CACAAACATTACACGCAGGCAGG - Intronic
925980697 2:9174680-9174702 CAGAAGAATCACTTGAAGCCAGG + Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926330160 2:11817838-11817860 CAGGAGAATTACATGAACCCAGG + Intronic
926452969 2:13028349-13028371 CAGGAAAATTGCTTGAAGCCAGG + Intergenic
926463324 2:13161020-13161042 CTCAAAAATTAGATGCAGGCAGG - Intergenic
926596124 2:14791285-14791307 TAGAAAAAAGGCATGAAGGCCGG - Intergenic
926602583 2:14862229-14862251 CAGAAAAATCACTTGAACCCGGG - Intergenic
926902307 2:17766258-17766280 CACAAGAATTACTTGAAGCCAGG - Intronic
927992331 2:27456950-27456972 CAGAAAAATTGCTTGAACCCGGG + Intronic
928098626 2:28421660-28421682 CAGAAGAATCACATGAACCCGGG - Intergenic
928573598 2:32632105-32632127 AAAAAAAATTAAATGGAGGCTGG - Intronic
928866631 2:35924695-35924717 GAGGAAAATTACATGGGGGCTGG - Intergenic
928912610 2:36438037-36438059 CAGAAAAATTGCTTGAACCCAGG + Intronic
929472303 2:42206508-42206530 CATAAAAACTAAATGCAGGCTGG - Intronic
929543015 2:42836762-42836784 CAGGAAAATCACATGAACCCAGG + Intergenic
929665156 2:43828124-43828146 GACACAAATTACAGGAAGGCTGG + Intronic
929715505 2:44305518-44305540 CAGAAAAATTGCTTGAACCCAGG - Intronic
929879659 2:45824766-45824788 CAGAAAACTCACATAAAGGGAGG - Intronic
929957067 2:46466173-46466195 CAGAAGAATTACTTGAACCCAGG + Intronic
930077083 2:47415085-47415107 CAGAAGAATCACTTGAAGTCAGG - Intronic
930387701 2:50718347-50718369 GACACAAATAACATGAAGGCTGG + Intronic
930452037 2:51553782-51553804 CAGAAATACTAAATGAAGGTTGG - Intergenic
931452221 2:62377836-62377858 CAGGAAAATTACTTGAACCCAGG + Intergenic
931465546 2:62483690-62483712 CAGGAAAATTACTTGAACCCAGG - Intergenic
931537157 2:63291714-63291736 CAGGAGAATTACTTGAATGCAGG + Intronic
932023812 2:68114075-68114097 CAGAAGAATTGCTTGAAGCCGGG + Intergenic
932232822 2:70096507-70096529 AAGAAAACATACATGAAGCCTGG + Intergenic
933273887 2:80263425-80263447 CAGAAGAATTACTTGAACCCAGG - Intronic
933734680 2:85486385-85486407 AAGAAAAACTACTTGAAAGCTGG + Intergenic
933758414 2:85658613-85658635 CAGGAGAATTACTTGAACGCAGG - Exonic
933808505 2:86017514-86017536 CAGGAAAATTGCTTGAACGCAGG - Intergenic
933817284 2:86078336-86078358 AAGAAAAATTAAATCAAGCCAGG - Intronic
934133830 2:88975291-88975313 CAGAAGGATTACATGAAGCCAGG - Intergenic
934249149 2:90333015-90333037 CAGAAAAATGGCATGAAGCCGGG - Intergenic
934260429 2:91470458-91470480 CAGAAAAATGGCATGAAGCCGGG + Intergenic
934303748 2:91802403-91802425 CAGAAAAATGGCATGAAGCTGGG + Intergenic
934329506 2:92050349-92050371 CAGAAAAATGGCATGAAGCTGGG - Intergenic
934467729 2:94280265-94280287 CAGAAAAATGGCATGAAGCCGGG - Intergenic
934546128 2:95218024-95218046 CAACAAAATAAAATGAAGGCAGG - Intronic
934588096 2:95523587-95523609 CAGAAAAATCACTTGAGGCCAGG + Intergenic
934854604 2:97721504-97721526 CAGAAGAATGACATGAACCCAGG - Intronic
935032085 2:99332348-99332370 CAGAATAATTGCTTGAAGCCGGG + Intronic
935390752 2:102550372-102550394 GAGAAAAATGTCATGAAAGCAGG - Intergenic
935574884 2:104698922-104698944 GAGAAAAATCACATGCAGTCTGG - Intergenic
936424924 2:112409567-112409589 CAGAAAGATCACTTGAAGCCAGG + Intronic
937134659 2:119542489-119542511 CAGAAAAATTGCTTGAGGCCAGG + Intergenic
937714755 2:125019114-125019136 CAGGAAGATTACTTGAATGCAGG - Intergenic
938058971 2:128237633-128237655 CAGAAAAATTGCTTGAACCCAGG - Intronic
938418392 2:131123615-131123637 CAGGAAAATTGCTTGAAGCCAGG - Intronic
938518872 2:132045386-132045408 CAGAAGAATGTCATGAAGCCAGG - Intergenic
938714352 2:134005915-134005937 CAGGAGAATTACTTGAAGCCAGG - Intergenic
939527385 2:143314000-143314022 CAATAAAATTACAAGGAGGCTGG - Intronic
939574857 2:143883565-143883587 GAGAAAAAATAAAGGAAGGCAGG - Intergenic
939881438 2:147635851-147635873 CTGAACAATTACATGAAGTGAGG - Intergenic
940028691 2:149237063-149237085 CAGAAAAATCTCTTGAAGGTAGG - Intergenic
940314589 2:152314631-152314653 CAGAAAAATCACTTGAACCCAGG - Intergenic
940475747 2:154160092-154160114 CAGATAAATCAAATAAAGGCTGG - Intronic
940663528 2:156577183-156577205 CAGAAAAATCAACTGATGGCTGG + Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941187249 2:162332214-162332236 CAGAAAAATGGCATGAACCCAGG + Intronic
941524875 2:166594838-166594860 CAGAAAAATTGCTTTAACGCAGG + Intergenic
941680467 2:168393107-168393129 CAGGAAGATTACTTGAAGCCAGG + Intergenic
941713400 2:168738976-168738998 CAGAAGAATTGCTTGAAGCCGGG - Intronic
941718902 2:168792540-168792562 CAGAAGAATTACTTGAATCCGGG - Intronic
942026734 2:171918155-171918177 CAGGCAAATCACATGAAGTCAGG - Intronic
942215465 2:173715016-173715038 CAGAAGAATTAAACAAAGGCAGG + Intergenic
942253544 2:174068378-174068400 CAGAAGAATTGCATGAATCCAGG - Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942966853 2:181905140-181905162 CAGGAGAATTACATGAACCCAGG - Intronic
943072962 2:183163902-183163924 TAGAAAGATGACATAAAGGCTGG + Intergenic
943205795 2:184892947-184892969 AAGAAAAATTATATAAAGGAAGG + Intronic
944255919 2:197623757-197623779 CAGGAAAATTACTTGAACCCGGG - Intronic
944332882 2:198493150-198493172 CAGAAAAATTATATCAAGGAAGG + Intronic
944730364 2:202510322-202510344 CAGAAAAATCACTTGAACCCAGG + Intronic
944737066 2:202576943-202576965 CAGAAAGATCACTTGAAGTCAGG + Intergenic
945076301 2:206043262-206043284 CAGAAGAATTGCTTGAACGCGGG - Intronic
945460457 2:210101881-210101903 CAGGAAAATTAGATGCAAGCAGG + Intronic
945672550 2:212819677-212819699 TAGAAGAAATACATGAAGGAAGG + Intergenic
946236043 2:218324840-218324862 CAGGAAAATTGCTTGAAGCCGGG + Intronic
946439961 2:219686803-219686825 CAGAAGAATTACTTGAACCCAGG - Intergenic
946727292 2:222673004-222673026 CAGAAGAATTACTTGAACCCGGG - Intronic
947086939 2:226464036-226464058 TAAGAAAATTACATGAAGGGTGG - Intergenic
947215543 2:227746370-227746392 CAGAAAAGTGCCATGAAGTCTGG - Intergenic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947577187 2:231285103-231285125 CAGGAAAATTACTTGAACCCAGG + Intronic
947634165 2:231671776-231671798 CAGAAAAATTACATGCTGGCTGG - Intergenic
947648513 2:231763932-231763954 TAGAAAAATAACATAAAGCCAGG - Intronic
948011604 2:234653464-234653486 CAGAAAAATCACTTGAACCCAGG - Intergenic
948477343 2:238228584-238228606 CAGAAGAATTACTTGAACCCAGG + Intronic
948499568 2:238381869-238381891 CAAAAAAATGACATGAAGACAGG + Intronic
1168758958 20:335565-335587 CAGAAAAATCACTTGAACCCGGG - Intergenic
1168894570 20:1314392-1314414 CAGGAGAATTACATGAACCCAGG + Intronic
1169162202 20:3390456-3390478 CAGGAAAATCACTTGAACGCAGG - Intronic
1169728316 20:8759996-8760018 CAGAAGAATCACTTGAAGCCAGG - Intronic
1169812058 20:9618497-9618519 CAGGAAAATTACTTGAACTCGGG - Intronic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1170156418 20:13273461-13273483 CAGGAAAATTACTTGAGGCCAGG - Intronic
1170264127 20:14445916-14445938 CAGCAAACTTGCATGATGGCAGG - Intronic
1170362718 20:15564696-15564718 CAGAAAAGTTGCAAGAATGCTGG + Intronic
1170581007 20:17699620-17699642 CAGGAAAACTGCATGAAGGATGG + Intronic
1170786883 20:19475040-19475062 CATAAAAATCACATCCAGGCTGG + Intronic
1170936385 20:20813602-20813624 CAGAAAAATTATATGCTGGCTGG - Intergenic
1171497263 20:25564543-25564565 CAGAAAGATCACCTGAAGTCAGG - Intronic
1171944430 20:31364094-31364116 CAGAAGAATTACTTGAACCCAGG + Intergenic
1172056368 20:32157247-32157269 CAGAAAATGTTCAGGAAGGCCGG - Intronic
1172111814 20:32550961-32550983 CAGAAGAATTACTTGAACACAGG + Intronic
1172190769 20:33060660-33060682 CAGAAGAATTGCATGAAGCCGGG - Intronic
1172206441 20:33166107-33166129 CAGAAGAATTACTTGAACCCAGG - Intronic
1172453506 20:35046959-35046981 CAGAAAAATTGCTTGAACCCAGG - Intronic
1172578410 20:36027766-36027788 CAGAAGAATCACTTGAAGCCAGG - Intronic
1172709984 20:36914441-36914463 CAGAAAAATAACTTGAACCCGGG - Intronic
1172710141 20:36915642-36915664 CAGAAAAATCACTTGAAGCCAGG + Intronic
1172863543 20:38077008-38077030 CAGAAGAATTGCTTGAAGTCAGG - Intronic
1172964966 20:38828119-38828141 GAGAAAAACAACATGAAGGAAGG - Intronic
1173567029 20:44048124-44048146 CAGAAAAATTGCTTGAACCCTGG + Intronic
1173671055 20:44799208-44799230 CAGGAGAATTACATGAACCCAGG + Intronic
1173978713 20:47206706-47206728 CAGAAAAATTGCTTGAATCCAGG + Intergenic
1174022972 20:47546622-47546644 CAGAAGAATCACTTGAATGCGGG - Intronic
1174027651 20:47591959-47591981 CAGAAAAAGTACTTGAAGAATGG - Intronic
1174372405 20:50100490-50100512 CAGAAAAATTGCTTGAACCCTGG + Intronic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174482389 20:50840920-50840942 CAGGAAAATTACTTGAACCCGGG - Intronic
1174493365 20:50920182-50920204 CAGAAAAATTGCTTGAATCCGGG + Intronic
1176725932 21:10432452-10432474 CAGAAGAATTACTTGAACCCAGG - Intergenic
1176766098 21:13020056-13020078 CAGAAAAATCACTTGAAACCGGG + Intergenic
1176820815 21:13653557-13653579 CAGAAAGATTACTTGAGGCCAGG - Intergenic
1176851313 21:13918338-13918360 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1176997029 21:15567337-15567359 CAGAAAAATTCCATGCAAGGAGG - Intergenic
1177168786 21:17632774-17632796 CAGGAGAATGACATGAACGCGGG + Intergenic
1178267093 21:31153760-31153782 CTTAAAAATCACAAGAAGGCTGG + Intronic
1178410016 21:32355699-32355721 CAGAAAAATTGCTTGAACCCGGG - Intronic
1178564721 21:33672802-33672824 CAGAAAAATTGCTTGAACCCGGG - Intronic
1178734019 21:35132352-35132374 CAGAAAAATTGCTTGAAGCCAGG + Intronic
1178822248 21:35985835-35985857 CAGGAAAATTGCATGAACCCGGG + Intronic
1178979518 21:37250805-37250827 CAGAAGAATTACTTGAACCCGGG + Intronic
1179964664 21:44795168-44795190 CAGGAGAATTACTTGAAGCCAGG + Intronic
1180389562 22:12214309-12214331 CAGGAAAATGACATGAACCCGGG - Intergenic
1180513283 22:16114802-16114824 CAGAAAAATCACTTGAAACCGGG + Intergenic
1180621499 22:17165702-17165724 CAGAAGAATTACTTGAGGCCAGG - Intergenic
1181157492 22:20932985-20933007 CAGAAAAATCACTTGAACACGGG + Intronic
1181618991 22:24074963-24074985 CAGAAAGATTACATGGGGCCAGG + Intronic
1181810099 22:25398756-25398778 AAGAAAAATTACATTAAGGCTGG + Intronic
1182049842 22:27304284-27304306 CAGAAAAAATGAATAAAGGCAGG + Intergenic
1182135173 22:27895291-27895313 AAGAAAAACAACATAAAGGCTGG + Intronic
1182218130 22:28736546-28736568 CTGCAAGATTACATCAAGGCCGG - Intronic
1182230815 22:28836247-28836269 AAAAAAAAGTTCATGAAGGCAGG + Intergenic
1182276257 22:29190543-29190565 CAGAAAGATCACATGAGGCCGGG + Intergenic
1182719354 22:32385074-32385096 CAGAAGAATCACATGAACCCGGG - Intergenic
1182724212 22:32429607-32429629 CAGAAGAATTGCTTGAAGCCGGG - Intronic
1183486686 22:38091148-38091170 CAGAATAATCACTTGAAGCCGGG - Intronic
1183505486 22:38206432-38206454 CAGAAGAATTGCATGAACCCGGG - Intronic
1183637509 22:39073378-39073400 CAGAAGAATTGCATGAACCCAGG + Intronic
1183881480 22:40835068-40835090 CTGAAAAATTAGGAGAAGGCGGG - Intronic
1183920873 22:41167088-41167110 CAGAAAAATCACATGAACCTGGG - Intronic
1184010868 22:41747295-41747317 TTGAAGAATTACCTGAAGGCTGG + Intronic
1184266133 22:43347363-43347385 CACAAAAATTACTTGAACGTGGG - Intergenic
1185214728 22:49591976-49591998 CAGGAAAATTAGATGACGGGAGG - Intronic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949560124 3:5193688-5193710 CAGAAGAATTACTTGAACTCAGG - Intronic
951204899 3:19915883-19915905 CAGAAGAATTACTTGAATCCGGG + Intronic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
951510758 3:23499557-23499579 CTTAGAAATTACATAAAGGCTGG - Intronic
951702537 3:25510531-25510553 CACAAGAATTACATGAACCCAGG + Intronic
951729734 3:25797360-25797382 CAAAAACATTATAAGAAGGCAGG - Intergenic
952127562 3:30319763-30319785 GAGAAACATAGCATGAAGGCAGG - Intergenic
952448931 3:33412488-33412510 CAGGAAAATCACTTGAAGACGGG + Intronic
952634689 3:35513962-35513984 TAGAAAAATTACTAGAAGGAAGG - Intergenic
952940073 3:38436909-38436931 CAGAAGAATTGCATGAAATCAGG + Intergenic
953321098 3:41972465-41972487 TAGAAAAATAACAACAAGGCTGG + Intergenic
953746049 3:45574889-45574911 CAGAAAAAAGACATCATGGCTGG + Intronic
953958549 3:47249236-47249258 CAGGAGAATTACATGAACCCGGG - Intronic
953978154 3:47398204-47398226 CAGGAAAATTACTTGAACCCAGG + Intronic
954030340 3:47814949-47814971 CAGGAGGATTACATGAAGCCAGG - Intronic
954241403 3:49296554-49296576 CAGAAAAATGGCATGAACCCGGG + Intronic
954253844 3:49389842-49389864 CAGAAAAATGGCATGAACCCAGG + Intronic
954338146 3:49932330-49932352 CAGGAAAATTGCTTGAACGCGGG - Intergenic
954350630 3:50040351-50040373 CAGGAAAATTGCATGAACCCGGG + Intronic
954445627 3:50545301-50545323 CAGAAAAATCAAGTGAAGGGTGG - Intergenic
954919057 3:54174106-54174128 CAGAGACAGTACATAAAGGCAGG + Intronic
955214770 3:56976132-56976154 CAGAAGAATTGCTTGAACGCAGG - Intronic
955365318 3:58305607-58305629 CAGAAGAATCACTTGAAGGGAGG + Intergenic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
955647403 3:61154709-61154731 CAAAATAATTACATTAATGCTGG + Intronic
955901319 3:63758898-63758920 CAGATAAATAATATGAGGGCTGG - Intergenic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
955941919 3:64154241-64154263 CATAAAAATTAACTCAAGGCTGG + Intronic
955972636 3:64450987-64451009 CAGAAAAATGATACAAAGGCTGG - Intergenic
956039366 3:65129977-65129999 CAGAAGAATCACTTGAACGCAGG + Intergenic
956106318 3:65822433-65822455 CAGAAAAATCACTTGAACCCAGG + Intronic
956122935 3:65984199-65984221 CAGGAAAATCACTTGAAGCCAGG + Intronic
956226661 3:66967584-66967606 CAGAAAAATCACTTGAACCCAGG - Intergenic
956413460 3:69002893-69002915 CAGAAGTATTACTTGAAGCCAGG - Intronic
956541931 3:70349279-70349301 CAGGAAAATTGCTTGAACGCAGG + Intergenic
956827641 3:73013729-73013751 CAGAAAAATTGCTTGAAACCAGG - Intronic
956874957 3:73453311-73453333 CAGAAGAATCACTTGAAGCCGGG + Intronic
957004785 3:74932513-74932535 CAGAAGAATTGCTTGAAGCCGGG + Intergenic
957235792 3:77588650-77588672 AAGAAAAATTATTTGAAGGCAGG - Intronic
957504451 3:81101540-81101562 CTGTAAAATTACATGAAATCAGG + Intergenic
957517427 3:81273922-81273944 CAGAAGAATTGCATGAATCCAGG + Intergenic
957676349 3:83371562-83371584 CAGACAAAATACATGAATGTAGG + Intergenic
957964980 3:87310564-87310586 CAGAAGAATTGCTTGAAGCCTGG + Intergenic
958732627 3:97974709-97974731 CAGAAACAATACATGTAGGAAGG - Intergenic
959018010 3:101158022-101158044 TTGAAAAATGACATGAAAGCTGG - Intergenic
959070942 3:101701536-101701558 CAGAAGAATTACTTGAACCCAGG + Intergenic
960314103 3:116155315-116155337 CAGAAGAATTACTTGAACCCAGG - Intronic
961039814 3:123669940-123669962 CAGAAGAATTGCATGAACCCAGG + Intronic
961169020 3:124782763-124782785 CAGAAAAATTGCTTGAACCCAGG + Intronic
961258694 3:125581601-125581623 CAGAAGAATCACATGAACCCTGG + Intronic
961538039 3:127581827-127581849 CAGAAGAATTGCATGAACCCAGG + Intronic
961771213 3:129251473-129251495 CAGAAAAATTGCTTGAACCCAGG - Intronic
962174687 3:133140772-133140794 CAGAAAATTAAAATGAAGTCTGG + Intronic
962547087 3:136447697-136447719 CAGGAAAATGACATGAACCCGGG - Intronic
962802354 3:138901245-138901267 CAGGAAAATTACTTGAACCCAGG - Intergenic
963168393 3:142227300-142227322 CAGGAGAATTACTTGAAGCCGGG + Intergenic
964110376 3:153081469-153081491 CAGAAGAATCACTTGAAGACAGG + Intergenic
964146538 3:153470648-153470670 CAGAAAAATCACTTGAGGCCAGG - Intergenic
964612578 3:158630075-158630097 CAGAAGAATTACTTGAACCCAGG + Intergenic
965173672 3:165301645-165301667 CAGAAGAATTGCTTGAATGCAGG + Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
965754146 3:172008117-172008139 TAAAAAAATTAAATGAAAGCAGG - Intergenic
965925083 3:173968789-173968811 CAGAAGAATTACATGAACCTGGG - Intronic
966164675 3:177004149-177004171 CAGAAAAATCACTTGAACCCAGG + Intergenic
966178288 3:177163414-177163436 CAGAAGAATCACATGAAACCAGG + Intronic
966444077 3:179980929-179980951 CAGGAAAATTGCTTGAAGCCTGG + Intronic
966974528 3:185072560-185072582 CAGAAGAATTGCTTGAAGCCGGG - Intergenic
966981044 3:185135873-185135895 CAAATAAATCACATGAAGGCAGG + Intronic
967071841 3:185969196-185969218 TAGAAAAAGTAAATGTAGGCTGG + Intergenic
967414765 3:189203946-189203968 CAGAAGAATTGCATGAACCCAGG + Intronic
967605686 3:191442921-191442943 CAGGACAATTAGATGATGGCTGG + Intergenic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
967765819 3:193278288-193278310 CAGACTAATTAGATGACGGCAGG - Intronic
967795067 3:193591154-193591176 CAGAAAAATTGCTTGAACCCAGG - Intronic
968259863 3:197312205-197312227 CAGAAAAATTGCTTGAACCCAGG - Intergenic
968777190 4:2549818-2549840 CAGAAAAATCACTTGAACTCAGG - Intronic
968782746 4:2595343-2595365 CAGAAAAAGAAACTGAAGGCTGG - Intronic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
969315172 4:6377564-6377586 CAGAAAAATTGCTTGAACCCGGG + Intronic
970102799 4:12544585-12544607 AAGTAAAATTACATGAAGAGTGG - Intergenic
970420656 4:15903103-15903125 CAGGAAAATCACTTGAATGCAGG - Intergenic
970978597 4:22070881-22070903 CAGAAGAATTACTTGAACCCTGG + Intergenic
971071223 4:23094312-23094334 CAGGAGAATTACATGAACCCGGG + Intergenic
971314016 4:25552228-25552250 CAGAAAAATCACTTGAAGCCAGG + Intergenic
971690282 4:29825314-29825336 CAGAAGAATAACTTGAAGCCAGG - Intergenic
971869652 4:32218450-32218472 CAGAAAAATCACTTGAACCCAGG - Intergenic
972284975 4:37639289-37639311 CAGAAAAATGGCATGAACCCAGG + Intronic
972397252 4:38668222-38668244 CAGAAAACTAATATTAAGGCAGG - Intronic
972433123 4:39003425-39003447 CAGAAAAATCACTTGAACCCAGG - Intronic
972470135 4:39396124-39396146 TACAAAAATTACCTGGAGGCCGG - Intergenic
972529464 4:39948715-39948737 CAGGAAAATTGCTTGAAGCCAGG - Intronic
972950530 4:44316883-44316905 CAGAAGAATGACATGAACTCAGG + Intronic
973344291 4:49037475-49037497 CAGGAGAATTGCATGAATGCGGG + Intronic
974042872 4:56872654-56872676 TAAAAAAATTCCATGAAGCCAGG + Intergenic
974061713 4:57041764-57041786 CAGGAGAATTACTTGAAGCCAGG - Intronic
974595207 4:64005223-64005245 CAGAAAAATAGCATGAACCCAGG - Intergenic
974935841 4:68408918-68408940 CAAAAAAAGTAAATAAAGGCAGG - Intergenic
975567327 4:75772327-75772349 CAGAAAAATTGCTTGAATCCGGG - Intronic
975585579 4:75944966-75944988 CAGGAGAATCACTTGAAGGCAGG - Intronic
976334059 4:83865235-83865257 CAGAAAACTTAAAAGAAGGCGGG - Intergenic
976355583 4:84113463-84113485 CAGAAAATTTACATGAGGGGTGG - Intergenic
976594392 4:86880938-86880960 CAGGAAAATTGCATGAACCCAGG + Intronic
976606800 4:86991057-86991079 CAGGAAAATTACTTGAACCCAGG + Intronic
977113008 4:92984402-92984424 CAGAAAAATTGTATGTAGACAGG - Intronic
977295824 4:95207881-95207903 CAGAGAAATTTCAGGAAGTCAGG - Intronic
977308022 4:95349786-95349808 GAGAAAAATGAGATAAAGGCAGG - Intronic
977605068 4:98976394-98976416 CAGAAGAATTGCATGAACCCAGG - Intergenic
977650773 4:99466667-99466689 CAGAAAAACCACATTTAGGCTGG + Intergenic
978003987 4:103594268-103594290 CAGAAGAATTACTTGAACCCGGG - Intronic
978114755 4:105005824-105005846 CAGAAAAATTGCTTGAACCCGGG - Intergenic
978258970 4:106729038-106729060 TAGAAAAATTAACTCAAGGCAGG + Intergenic
978548883 4:109903096-109903118 CAGAAAAATCACTTGAAACCAGG - Intergenic
978697672 4:111602090-111602112 CAGAAAAATTACATATAGGTTGG + Intergenic
978748416 4:112221306-112221328 CAGAAGAATTACTTGAACCCCGG - Intergenic
978953031 4:114583750-114583772 CAGAAAAATTGCTTGAATCCAGG + Intergenic
979722930 4:123923899-123923921 CAGAACAATTACACTGAGGCAGG - Intergenic
979804671 4:124956277-124956299 CAGAAAAACTACTTGAACCCGGG + Intergenic
980624471 4:135356302-135356324 CAGAAGAATTGCTTGAATGCAGG + Intergenic
980827881 4:138093811-138093833 CAGAAAAATTACCACAAGACTGG + Intergenic
981007988 4:139895314-139895336 AATATAAGTTACATGAAGGCAGG + Intronic
981012291 4:139937874-139937896 TAGGAAAATTGCATGTAGGCAGG - Intronic
982572756 4:157071127-157071149 CGGAAAAATTATATGATGCCTGG + Intergenic
982606048 4:157517570-157517592 CAGAAAAATTGCTTGAACCCAGG - Intergenic
982620737 4:157701372-157701394 CAGAAAATTTACACTAAGGTGGG - Intergenic
982654077 4:158124150-158124172 CAGAAAAATTATATGAAACGTGG - Intergenic
982795170 4:159635670-159635692 CAGGCAAATTACTTGAAGCCAGG - Intergenic
982950871 4:161693932-161693954 TAAAAGAATTACAAGAAGGCTGG - Intronic
983108066 4:163714907-163714929 CAGGAAAATTACTTGAGGCCAGG - Intronic
983111058 4:163749974-163749996 CAGAAGAATTACTTGAACGTGGG + Intronic
984085060 4:175300131-175300153 CAAAAAATTTCCATGAAGCCAGG - Intergenic
984089010 4:175347159-175347181 CAAAAAAATCACATGAACCCAGG + Intergenic
984135988 4:175939926-175939948 CAGAAATATTATATGTAGTCTGG - Intronic
984334763 4:178376823-178376845 CAGAAAAATTACTTGAACTGGGG + Intergenic
985284590 4:188322573-188322595 CAGAAGAATTGCTTGAAGCCAGG + Intergenic
986252291 5:6071596-6071618 CTGGAATATTACATGAATGCAGG - Intergenic
986515914 5:8563583-8563605 CAGAAGAATTACTTGAACCCGGG + Intergenic
987122094 5:14777191-14777213 CAGAAAAATTGCTTGAACACGGG + Intronic
987241698 5:16006675-16006697 CACAAAAATTACTTGAACCCGGG - Intergenic
987372789 5:17208443-17208465 CAGAAGAATTGCTTGAACGCAGG + Intronic
987784054 5:22476052-22476074 TAGAATAGTTACATGAAGGGAGG - Intronic
988160131 5:27508788-27508810 CAGAATAATTACTTGAACCCTGG - Intergenic
988212945 5:28229736-28229758 CAGGAGAATCACTTGAAGGCAGG + Intergenic
988504619 5:31811078-31811100 CAGAAGAATTGCTTGAAGCCGGG - Intronic
988978490 5:36539491-36539513 CAGAAAAATTGCTTGAACCCTGG + Intergenic
989032028 5:37128764-37128786 CAGAAAAATTGCTTGAACCCAGG + Intronic
989121511 5:38009209-38009231 CAGAAAAATTGCTTGAACCCAGG - Intergenic
989281015 5:39643394-39643416 CAGAAAATTTAACTGAATGCTGG + Intergenic
989302075 5:39906884-39906906 CAAGTAAACTACATGAAGGCAGG - Intergenic
990397323 5:55395311-55395333 CAGAAAAATTGCTTGAACCCGGG + Intronic
990427581 5:55702484-55702506 CAGAAAGATTACTTGAGGTCAGG - Intronic
990574157 5:57108634-57108656 CAGAAAAATTGCTTGAACCCGGG + Intergenic
990576616 5:57129459-57129481 ATGAAATATTACATGTAGGCCGG + Intergenic
990936048 5:61150508-61150530 AAGAGAAATTATGTGAAGGCAGG + Intronic
991388750 5:66119537-66119559 CAGAAAAGTTATGTGAAGACTGG + Intergenic
991700880 5:69315264-69315286 AAAAAAAATAACCTGAAGGCTGG + Intronic
991869508 5:71096753-71096775 CAGAAAAATCACTTGAACCCGGG - Intergenic
991914848 5:71595211-71595233 CAGGAGAATTGCATGAAGCCAGG + Intronic
991943369 5:71876437-71876459 TATAAAAATCACATGCAGGCCGG - Intergenic
992471010 5:77053522-77053544 AAGAAAAAATATAGGAAGGCGGG + Intronic
992611632 5:78513048-78513070 TTGAAAAATTACATTCAGGCAGG - Intronic
992882811 5:81127428-81127450 CAGAAAAATCACTTGAGGCCAGG + Intronic
993335164 5:86648146-86648168 AATAAAAATTACATGAATGCAGG - Intergenic
993731071 5:91423680-91423702 CAGGAAGATTACTTGAAGGCAGG - Intergenic
993757013 5:91744210-91744232 CAGAAAAATGGCATGAACCCAGG + Intergenic
993904258 5:93605234-93605256 AGGTTAAATTACATGAAGGCAGG - Intergenic
994005824 5:94836085-94836107 CAGAAAAATTGCTTGAACCCAGG + Intronic
994323348 5:98419348-98419370 CAGAATAACTACCTGAAAGCAGG + Intergenic
994343881 5:98662949-98662971 CAGAAAAATCACTTGAACCCAGG + Intergenic
994496844 5:100523397-100523419 CAGGAAAATTGCTTGAAGCCTGG + Intergenic
994577418 5:101595875-101595897 CAGAGAATTTACATGAATTCAGG + Intergenic
994632370 5:102301840-102301862 CAGGAAAATTGCATGAACCCTGG + Intergenic
994755422 5:103788949-103788971 CAGAAAAATTGCTTGAACCCCGG - Intergenic
995448924 5:112278970-112278992 CAGAAGAATTGCTTGAACGCAGG + Intronic
995452258 5:112314698-112314720 CAGGAAAATTGCCTGAAGCCAGG + Intronic
995657485 5:114443196-114443218 CAGAAGAATTGCTTGAACGCAGG + Intronic
995720968 5:115132441-115132463 CAGAAAAATTGCTTGAACCCAGG + Intronic
996214485 5:120850213-120850235 CAGGAAGATTGCTTGAAGGCAGG + Intergenic
996435357 5:123428128-123428150 CACAAAAATTAAAAGAAGCCAGG - Intergenic
996706616 5:126504655-126504677 AAGAAAAATGACATGAAAGCAGG + Intergenic
997272605 5:132554272-132554294 CAGAAGAATCACTTGAACGCGGG + Intronic
997545470 5:134703122-134703144 CAGAAAAATTTCAAGTAGACTGG - Intronic
997554000 5:134778987-134779009 CAGAAGAATCACTTGAAGCCAGG - Intronic
997945551 5:138197587-138197609 CAGAAGAATCACATGAACCCGGG - Intronic
998048886 5:139014272-139014294 CAGGAAAATTACTTGAACCCAGG + Intronic
998119516 5:139564244-139564266 CAGAAAAATCACTTGAACCCAGG - Intronic
998355502 5:141532157-141532179 CCAAAAAATTAAGTGAAGGCGGG - Intronic
998559220 5:143155461-143155483 CATAAAAATTGGATGAAGGCAGG - Intronic
998970647 5:147588169-147588191 TAGAAAAATTTCATGAAAGAGGG - Intronic
998979340 5:147683838-147683860 AAGTAAAAGTACATGAAGGTTGG + Intronic
999285868 5:150393916-150393938 CAGAAGAATGACTTGAAGCCAGG + Intronic
999317361 5:150592988-150593010 CAGAGACATAACAGGAAGGCAGG - Intergenic
999746526 5:154596333-154596355 CAGAAGAATAACTTGAACGCAGG + Intergenic
999945746 5:156593315-156593337 CTGAAAAATTACATTGAAGCAGG - Intronic
1000055004 5:157597962-157597984 CAGGAAAATTACTTGAACCCAGG + Intergenic
1000556242 5:162729663-162729685 AAGAAAAATTTCATTAAGCCTGG - Intergenic
1001150415 5:169222783-169222805 CAGAGCCATTACATGAATGCAGG + Intronic
1002270969 5:178071707-178071729 CACAAAAATTGCATGAACCCGGG + Intergenic
1002289656 5:178191203-178191225 CAGAAGAATTACTTGAACCCGGG + Intergenic
1003262140 6:4527720-4527742 CAGACAAATTACCTGAGGCCAGG + Intergenic
1003889330 6:10550144-10550166 CAGAAGAATTACTTGAACCCGGG - Intronic
1004154340 6:13154255-13154277 CAGGAAAATTACTTGAACCCAGG - Intronic
1004804971 6:19193588-19193610 CAGAAAAGAGCCATGAAGGCAGG - Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1005011045 6:21336086-21336108 TAGAAAAATTAAATGCTGGCCGG + Intergenic
1005050993 6:21683668-21683690 CAGGAAAATTACTTGAATCCAGG + Intergenic
1005131740 6:22516721-22516743 CAGGAAAATTACTTGAACCCAGG - Intergenic
1005226882 6:23653499-23653521 CAGAAAGATGGCATGAATGCTGG + Intergenic
1005270847 6:24161456-24161478 CAGAAGAATTACTTGAACTCAGG + Intergenic
1005317715 6:24620391-24620413 CAGAAGAATTGCATGAATCCAGG - Intronic
1005318014 6:24622944-24622966 CAGAAAAATTACTTGAACCCAGG + Intronic
1005330841 6:24748648-24748670 CAGAAGAATTGCTTGAAGCCGGG + Intergenic
1005417157 6:25612158-25612180 CTGAAAATGTACATGAAGTCTGG + Intronic
1006032697 6:31188935-31188957 CAGAAAAATCACTTGAACCCAGG - Intergenic
1006033888 6:31197313-31197335 CAGAAAAATGGCTTGAACGCGGG - Intergenic
1006086986 6:31603040-31603062 CAGAAGAATCACTTGAACGCAGG - Intergenic
1006507376 6:34498152-34498174 CAGAAAAATCACTTGAACCCGGG - Intronic
1006663146 6:35666592-35666614 AAGAAAATGTATATGAAGGCTGG + Intronic
1006716862 6:36126007-36126029 AAGCAAAATTACAAGGAGGCAGG - Intergenic
1007009064 6:38397127-38397149 CAGACAAATCACTTGAAGCCAGG - Intronic
1007118046 6:39357743-39357765 CTTAAGAATTACATCAAGGCCGG - Intronic
1007188303 6:39991987-39992009 CAGAAGAATTGCTTGAACGCAGG - Intergenic
1008253273 6:49266423-49266445 CAGAAAAATACCAGGAGGGCAGG + Intergenic
1008311706 6:49983742-49983764 CAGAAAAATCACTTGAACCCGGG - Intergenic
1008634294 6:53394166-53394188 CAGAAGAATTGCTTGAAGCCAGG + Intergenic
1008651346 6:53566405-53566427 CAGAAGAATTACTTGAACCCGGG + Intronic
1009330985 6:62419480-62419502 CAGAAGAATCACTTGAAGCCAGG - Intergenic
1009372170 6:62919135-62919157 CAGGAAAATTGCATGAACCCGGG - Intergenic
1009542302 6:64976983-64977005 CAGGAAAATCACATGAACCCAGG - Intronic
1009946817 6:70349406-70349428 CAGAAGAATTACTTGAACCCAGG + Intergenic
1010839113 6:80626347-80626369 CAGGAGAATTACATGAACCCAGG + Intergenic
1010891889 6:81323355-81323377 CATAAAAATTAAATGAGGCCGGG + Intergenic
1010926103 6:81748463-81748485 TAAAAAAATTAAATGAAGGAGGG - Exonic
1010964935 6:82193976-82193998 TAGAAAAGTCAAATGAAGGCTGG - Intronic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1011315642 6:86027985-86028007 CAGAAAAATGGCATGAACCCGGG - Intergenic
1012183777 6:96188357-96188379 CAGAAAAATTGCTTGAATCCAGG - Intronic
1012810932 6:103957000-103957022 CAGAAGAATTACTTGAACCCGGG + Intergenic
1012952573 6:105534555-105534577 CAGAAAAATCACTTGAACCCGGG - Intergenic
1013135816 6:107281996-107282018 CAGAAAAATTGCTTGAACCCAGG - Intronic
1013178516 6:107698544-107698566 CAGCAAAAAAACATGGAGGCAGG + Intergenic
1013333334 6:109128900-109128922 CTGAAAAACTAACTGAAGGCCGG + Intronic
1013342562 6:109229570-109229592 AAGAAATATTGCATTAAGGCCGG - Intergenic
1013709068 6:112875779-112875801 CAGAAAACTTGCATGAAGAAGGG + Intergenic
1013724482 6:113076820-113076842 TAGAAAAAATCCATGCAGGCAGG + Intergenic
1013740076 6:113273005-113273027 AAGAAAAATTACATGGTGGGAGG - Intergenic
1014074285 6:117218886-117218908 CAGAAAACTTAAATGACAGCAGG - Intergenic
1014197878 6:118579817-118579839 CAGAAAAATGGCCTGAAGGGCGG + Intronic
1014230590 6:118897801-118897823 CAGAGGAATTAAATGAAAGCTGG + Intronic
1014293572 6:119589979-119590001 CAGAAAAATTGAATGAAAGAAGG - Intergenic
1014297406 6:119637101-119637123 ATGAAAAATTACATGATGCCGGG + Intergenic
1014453865 6:121614594-121614616 CAGAAAAATAGCATGAAAGGAGG + Intergenic
1014744019 6:125178691-125178713 AAGAAAAAATCAATGAAGGCAGG + Intronic
1015283995 6:131464225-131464247 CAGAAAAATCACTTGAACCCAGG - Intergenic
1015535240 6:134260577-134260599 CAGAAGAATTACTTGAACTCAGG + Intronic
1015652923 6:135482982-135483004 CAGGAGAATTACTTGAAGCCGGG - Intronic
1016676456 6:146775517-146775539 CAGTAATTATACATGAAGGCAGG - Intronic
1016684078 6:146861973-146861995 CAGAAATATTCCATGAAGAAGGG + Intergenic
1016811380 6:148264446-148264468 CACAAGAATTACATGAAGACTGG + Intergenic
1017117374 6:150990946-150990968 CAGGAAAATCACTTGAACGCAGG - Intronic
1017448536 6:154531149-154531171 CAGAAGAATTACTTGAACCCGGG + Intergenic
1018232332 6:161687547-161687569 CAGAAAAATTGCTTGAACCCAGG - Intronic
1018240146 6:161766398-161766420 CAGAAGAATTACTTGAACCCGGG - Intronic
1018459050 6:163980178-163980200 CAGAATAATTACATGACCCCGGG - Intergenic
1019013064 6:168858231-168858253 TACAAAAAATAAATGAAGGCCGG - Intergenic
1020292675 7:6734331-6734353 CAGGAGAATTACATGAACCCAGG - Intergenic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1020618488 7:10489999-10490021 CAGACAGATTACATGAGGCCAGG - Intergenic
1020705473 7:11538538-11538560 CAGAAAAATTAAAATAGGGCGGG + Intronic
1021108912 7:16671836-16671858 CAGGAAAATCACATGAACCCAGG + Intronic
1021167633 7:17360234-17360256 CAGATAAATGACCTGATGGCGGG - Intergenic
1021198072 7:17694442-17694464 CAGGAAAATTGCTTGAGGGCAGG - Intergenic
1021398477 7:20180752-20180774 CAGAAAAATCACTTGAATCCGGG + Intronic
1021524738 7:21574654-21574676 CAGAAGAATCACTTGAAGCCAGG - Intronic
1021562508 7:21982474-21982496 GAGAAATATTAAATGAGGGCAGG + Intergenic
1021834497 7:24655751-24655773 CAGGAAAATTACTTGAACCCGGG - Intronic
1021879251 7:25077710-25077732 CAGAAGAATCACTTGAACGCAGG + Intergenic
1021996403 7:26182325-26182347 CAAAATAATTCCATGTAGGCCGG + Intronic
1022047563 7:26634588-26634610 CACACAAATTACCTGCAGGCAGG - Intergenic
1022115383 7:27256237-27256259 CAGAAGAATTACTTGAACCCGGG + Intergenic
1022324810 7:29321661-29321683 CAGGAGAATTACTTGAACGCGGG - Intronic
1022630057 7:32076342-32076364 CAGAAAAATGACATCAGGGCTGG + Intronic
1022956238 7:35384383-35384405 CAGGAAAAAAAAATGAAGGCAGG + Intergenic
1022989126 7:35690714-35690736 CAGGAGAATTGCTTGAAGGCGGG + Intronic
1023158604 7:37276310-37276332 CACAAAAATAACACGTAGGCCGG + Intronic
1023449427 7:40266921-40266943 CAGAAGAATCACTTGAAGCCAGG + Intronic
1023644583 7:42296444-42296466 CAGAAAAATCACTTGAGGTCAGG - Intergenic
1023953656 7:44868413-44868435 CAGAAGAATTGCATGAACCCGGG - Intergenic
1024473102 7:49783512-49783534 CAGAAAAGTACCATGAAGGATGG - Intronic
1024643115 7:51348223-51348245 CAGAAGAATTGCTTGAAGCCAGG - Intergenic
1024969805 7:55058299-55058321 CAGGAAAATTGCTTGAACGCGGG + Intronic
1025100081 7:56127137-56127159 CAGAAGAATCACTTGAATGCGGG + Intergenic
1025154716 7:56594346-56594368 CAGAAGAATTACTTGAACCCAGG - Intergenic
1025264990 7:57449506-57449528 CAGAAAAATCACTTGAACCCAGG - Intergenic
1025307478 7:57875993-57876015 CAGAAGAATGGCATGAAGCCAGG - Intergenic
1025321535 7:58099603-58099625 CAGAAGAATCACTTGAAGCCGGG - Intergenic
1025481194 7:60985163-60985185 CAGAAAACTGGCATGAAGCCGGG + Intergenic
1025838213 7:65116435-65116457 CAGAAGAATGGCATGAAGCCGGG + Intergenic
1025879060 7:65516649-65516671 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1025884858 7:65579539-65579561 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026792129 7:73341014-73341036 CAGGAAAATTGCTTGAAGCCAGG - Intronic
1027199829 7:76056918-76056940 CAGGAGAATCACATGAAGCCGGG + Intronic
1027381350 7:77613265-77613287 CAGGAAAATCACATGAACCCGGG - Intronic
1027489622 7:78806773-78806795 CAGAAAAATCACTTGAACTCAGG + Intronic
1027776534 7:82472403-82472425 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1027823065 7:83073134-83073156 TGGAAATATTACAAGAAGGCAGG + Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1029265724 7:99338476-99338498 CAGGAAAATTACTTGAACCCGGG - Intronic
1029450229 7:100637499-100637521 CACAAAAATCACCTGAAGCCGGG + Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1030036651 7:105413395-105413417 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1030258840 7:107541836-107541858 CAGAAGAATTGCTTGAAGCCAGG + Intronic
1030506253 7:110427073-110427095 GACAAAAATTACATAAAGGATGG + Intergenic
1030845041 7:114399402-114399424 AAGAAAAAATAAGTGAAGGCTGG - Intronic
1030908926 7:115222589-115222611 CTGAAAAATAAAATGAATGCTGG + Intergenic
1031012269 7:116536705-116536727 CAGAAAAAAGCCATTAAGGCCGG + Intronic
1031339511 7:120581802-120581824 CAGGAGAATTGCATGAACGCAGG - Intronic
1031610805 7:123824780-123824802 CTGTTAAATTACATGAAGGCAGG + Intergenic
1031636287 7:124104903-124104925 CAGAAGAATTGCATGAACCCGGG + Intergenic
1031724839 7:125225263-125225285 TAGAAAATTTACATAAAAGCAGG + Intergenic
1032112306 7:129086608-129086630 CAGAAAAATTGCTTGAACCCGGG - Intergenic
1032360726 7:131252419-131252441 CAGAAGAATCACATGAACCCAGG - Intronic
1032866890 7:135934828-135934850 CAGAGAAAGTAAAGGAAGGCAGG - Intronic
1032903136 7:136333865-136333887 CAATAAAATGACATGAATGCTGG + Intergenic
1033130427 7:138741049-138741071 CAGAAGAATTACTTGAAACCAGG + Intronic
1033164778 7:139030350-139030372 CAGAAGAATTACATGAACCGGGG + Intronic
1033183297 7:139201819-139201841 CAGAAAAATCACTTGAACCCGGG - Intergenic
1033318748 7:140320491-140320513 CAGAAAAATCACTTGAACCCAGG + Intronic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033883651 7:145917617-145917639 CAGGAAAATTACTTGAACCCAGG + Intergenic
1034316103 7:150134873-150134895 CAGAAAAATTAAATGAACACCGG + Intergenic
1034620866 7:152456124-152456146 AAGAAAAATTACATGGAAGATGG + Intergenic
1034710525 7:153187141-153187163 CAGACATATCACATGAAAGCAGG + Intergenic
1034790785 7:153965908-153965930 CAGAAAAATTAAATGAACACCGG - Intronic
1035369520 7:158370445-158370467 AAGAAAAAATAAATAAAGGCTGG + Intronic
1035773868 8:2172299-2172321 CAGCAACATTACATTAATGCAGG - Intergenic
1036060680 8:5316220-5316242 CAAAAAAATTACATGAGTTCAGG - Intergenic
1038123171 8:24641330-24641352 CAGGAAAATCACTTGAAGCCGGG + Intergenic
1038145954 8:24895924-24895946 CAGGAAGATTACTTGAAGCCAGG + Intergenic
1038390570 8:27196231-27196253 GAGAATAATGACATGAAGCCTGG - Intergenic
1038627009 8:29203799-29203821 CAGGAAAATTGCTTGAAGCCGGG + Intronic
1038984166 8:32790708-32790730 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1039098312 8:33911574-33911596 CAGGAGAATTACATGAATCCAGG + Intergenic
1039189696 8:34958999-34959021 CAGAAGAATGACATGAACCCAGG - Intergenic
1039415531 8:37390686-37390708 CAAAAAAAGTACATTATGGCGGG + Intergenic
1039503544 8:38035025-38035047 CAGGAAAATTACTTGAGGCCAGG + Intronic
1039703511 8:39984764-39984786 CAGAGAAATGACATCAATGCAGG + Intronic
1039731530 8:40284070-40284092 CAGAAAAATTGCTTGAACCCGGG + Intergenic
1040608766 8:48962069-48962091 CAAAAAAAGTACATGAATACTGG - Intergenic
1040758640 8:50810616-50810638 CAGAAAAAATTGATAAAGGCCGG - Intergenic
1040805135 8:51386722-51386744 CAGAAAAATTGCTTGAACCCAGG + Intronic
1040856687 8:51955913-51955935 CAGAAGAATTACTTGAACCCGGG + Intergenic
1041094158 8:54332763-54332785 CAGAAGAATTACTTGAACCCAGG - Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041588793 8:59551355-59551377 CAGAAAAATTACTAGAAACCAGG - Intergenic
1041695359 8:60730562-60730584 TAGAAATATTAAATGGAGGCCGG + Intronic
1042546510 8:69956078-69956100 CAGAAAAATAACATGATCGCCGG + Intergenic
1042554553 8:70023018-70023040 CAGAAAAATCACTTGAACCCAGG - Intergenic
1042855662 8:73264581-73264603 CAGAAGAATCACATGAACCCGGG - Intergenic
1042869065 8:73380898-73380920 CAGAAAAATCACTTGAAGCCAGG + Intergenic
1043414717 8:80034839-80034861 CATCAAAATTACATGAGAGCTGG + Intronic
1044305199 8:90632237-90632259 CAGAAAAATTGCTTGAACCCAGG - Intronic
1044448461 8:92305817-92305839 CAGGAAAATCACATGAACCCAGG - Intergenic
1044454242 8:92374153-92374175 CTGATAAATTTTATGAAGGCTGG + Intergenic
1046227395 8:111301509-111301531 CATAAAATTTATATGAAGGCTGG - Intergenic
1046411596 8:113851349-113851371 CAGAAAAATTCCTTGAACCCGGG - Intergenic
1046443905 8:114290113-114290135 CATAAAAATTACATAATGTCTGG - Intergenic
1046714513 8:117552773-117552795 CAGAAGAATCACTTGAACGCGGG + Intergenic
1046872840 8:119222435-119222457 CAGAAGAATTACTTGAACCCGGG + Intronic
1046916042 8:119679502-119679524 CACAAAAAGTTGATGAAGGCTGG + Intergenic
1046941490 8:119935626-119935648 CAGAAAAATTGCTTGAACCCAGG + Intronic
1046950220 8:120013062-120013084 CAGAAGAATCACATGAACCCGGG + Intronic
1047039725 8:120979409-120979431 CAGGAAAATTACTTGAACCCAGG + Intergenic
1047243872 8:123121044-123121066 CAGGAGAATTACATGAACTCAGG - Intronic
1047578000 8:126179617-126179639 CAGAAAAACCACAACAAGGCAGG + Intergenic
1047956428 8:129979826-129979848 CAGAAGAATTGCTTGAAGCCAGG + Intronic
1048237997 8:132711284-132711306 CAGAAAAATGCCATAAGGGCAGG - Intronic
1049117132 8:140698705-140698727 CAGAAGAATTACTTGAACCCAGG - Intronic
1050427377 9:5525250-5525272 CAGAAAAATTGCTTGAACCCAGG + Intronic
1051389090 9:16544095-16544117 CAGAAAATTGACATAAAGGGGGG - Intronic
1051485140 9:17600162-17600184 CATTAAAATTACATGAACGCTGG + Intronic
1051945338 9:22562927-22562949 CAGAAGAATGGCATGAACGCGGG - Intergenic
1052858495 9:33422268-33422290 CAGAAAAATTGCTTGAACCCAGG - Intergenic
1053257226 9:36627992-36628014 CAGAAAAATCACTTGAACCCGGG - Intronic
1053400845 9:37820434-37820456 CAGAATCACTACATGAAGTCCGG + Intronic
1053405162 9:37868034-37868056 TAGAAAGATTCCATGTAGGCTGG + Intronic
1053698143 9:40658336-40658358 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1053944150 9:43288545-43288567 CAGAAAAATGGCATGAAGCTGGG - Intergenic
1054309434 9:63457744-63457766 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054408228 9:64781881-64781903 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054441375 9:65265693-65265715 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054488902 9:65755796-65755818 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1054604419 9:67160904-67160926 CAGGAGAATGACATGAAGCCGGG - Intergenic
1055289609 9:74769236-74769258 CAGAAGAATCACATGAACCCAGG - Intronic
1055487497 9:76771484-76771506 CAGCAATGTGACATGAAGGCAGG + Intronic
1055846898 9:80576057-80576079 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1056017118 9:82401500-82401522 CAGGAAAATTGCATGAACCCAGG + Intergenic
1056299439 9:85226567-85226589 CAGAAGAATTACTTGAACCCAGG - Intergenic
1056566209 9:87774821-87774843 TAGAAATATTGCATGTAGGCCGG - Intergenic
1056615555 9:88162510-88162532 CAGAAGAATTGCTTGAAGCCAGG - Intergenic
1057574347 9:96229757-96229779 CAGAAAAATTGCTTGAACCCAGG + Intergenic
1058358545 9:104112423-104112445 CAGAAAAAATACATGTACACAGG + Intronic
1058542552 9:106026922-106026944 CAGGAAAATTACTTGAACCCAGG + Intergenic
1058626582 9:106939679-106939701 CAGAAGAAATACAGGAAGCCAGG + Intronic
1058972007 9:110092237-110092259 CAGGAGAATTACATGAACCCGGG + Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059175315 9:112164849-112164871 CAGAAGAATCACTTGAAGCCGGG + Intronic
1059348056 9:113645701-113645723 CAGAAACACAACATGAATGCTGG + Intergenic
1059845598 9:118272450-118272472 CAGAAAGAGAACATGAAGTCAGG - Intergenic
1060363231 9:122981251-122981273 CAGACAGATTACTTGAAGCCAGG - Intronic
1060381804 9:123182120-123182142 CAGAAGAATTACTTGAACCCGGG + Intronic
1060546200 9:124461838-124461860 CAGGAAAATCACTTGAACGCGGG - Intronic
1060562933 9:124561817-124561839 CAGAAAAATTGCTTGAACCCAGG + Intronic
1060582246 9:124759945-124759967 CAGAAAAATTGCTTGAACCCAGG + Intronic
1060645441 9:125275166-125275188 CAGAAGAATCACTTGAAGCCAGG - Intronic
1060844112 9:126821281-126821303 CAGGAGAATTGCTTGAAGGCAGG + Intronic
1061554693 9:131359936-131359958 CAGAAAAATTGCTTGAACCCGGG + Intergenic
1062594193 9:137290523-137290545 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1202780506 9_KI270717v1_random:31527-31549 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1203788027 EBV:138704-138726 TAGAATATTTGCATGAAGGCAGG - Intergenic
1203526542 Un_GL000213v1:95996-96018 CAGAAAGATTACTTGAGGCCAGG + Intergenic
1203587285 Un_KI270747v1:17123-17145 CAGAAAAATGGCATGAAGCTGGG - Intergenic
1185473471 X:399107-399129 CAGAAAGTGTACTTGAAGGCCGG - Intergenic
1185791983 X:2934130-2934152 CAGAAGAATTGCTTGAAGCCGGG - Intergenic
1185916877 X:4045430-4045452 CAGAAAAATCACTTGAACCCAGG - Intergenic
1186382836 X:9078966-9078988 CTCAAAAATTATATGGAGGCTGG + Intronic
1186392360 X:9173758-9173780 AAGAAGATTTACATGCAGGCAGG + Intergenic
1187053146 X:15714165-15714187 CAAAAACATTACATGAAGACAGG - Intronic
1187057832 X:15757613-15757635 CAGGAAAATTGCTTGAACGCAGG + Intronic
1187136911 X:16557033-16557055 CAGAAAAATTATAATAAGCCCGG + Intergenic
1187150723 X:16679263-16679285 CAGAAGAATCACATGAACCCAGG + Intronic
1187199576 X:17121841-17121863 CAGGAAAATTACTTGAACCCGGG - Intronic
1187389380 X:18875806-18875828 CAGAAAAATGACATGAATTAGGG + Intergenic
1187605030 X:20873979-20874001 CAGGAGAATTACATGAACCCTGG - Intergenic
1188288417 X:28358298-28358320 CAGAAGAATTGCTTGAATGCGGG + Intergenic
1188450436 X:30302910-30302932 AGGAAAAATTACATGAAGTTAGG + Intergenic
1188915710 X:35907700-35907722 CAGAAAAATAACAAAATGGCAGG - Intergenic
1189244467 X:39552776-39552798 CAGCACAATAAAATGAAGGCAGG - Intergenic
1189367491 X:40400201-40400223 CAGAAAAACTAGATTTAGGCTGG - Intergenic
1189426814 X:40909332-40909354 AAGACAAATTTCATTAAGGCAGG + Intergenic
1189542004 X:42001676-42001698 CAAAAAAATTAAAAGAAAGCTGG - Intergenic
1189664330 X:43336843-43336865 CAGAAGAATCACTTGAACGCAGG + Intergenic
1190738009 X:53268403-53268425 CAGCAAAATCACATGAAGCAGGG + Intronic
1191677234 X:63804169-63804191 CAGACAAATTAAATCCAGGCAGG + Intergenic
1191757538 X:64609911-64609933 CAGAAGAATTGCTTGAAGCCAGG + Intergenic
1191967145 X:66771619-66771641 CAGAAGAATTACTTGAACCCGGG - Intergenic
1192785807 X:74334437-74334459 CAGAAGAATGACATGAACGCAGG - Intergenic
1193077712 X:77373092-77373114 CAGGAAAATTACTTCAAGGTGGG + Intergenic
1193436663 X:81481960-81481982 CAGAAGAATTGCTTGAATGCAGG + Intergenic
1193472854 X:81927811-81927833 CAGAAGAATTACTTGAACCCGGG + Intergenic
1193846243 X:86474824-86474846 CAGAAAAATTGCTTGAACCCAGG - Intronic
1194284275 X:91990569-91990591 CAGAAAATTTAAATGAAGTTTGG - Intronic
1194290892 X:92070890-92070912 CAGGAAAATTACTTGAACCCAGG - Intronic
1194357257 X:92901233-92901255 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1195106133 X:101603143-101603165 CATAAAAATAAAATGAAGGCAGG - Intergenic
1195693929 X:107652841-107652863 CAGGAAAATCACATGAATCCGGG - Intergenic
1196085384 X:111678543-111678565 CAGATAAATTACACTTAGGCAGG - Intronic
1196719042 X:118836635-118836657 CAGGAGAATTACATGAGGCCAGG + Intergenic
1198021613 X:132664303-132664325 TAGAAAAATAAAGTGAAGGCTGG - Intronic
1198219649 X:134587664-134587686 CAGAACAATTTCATGAAGAGAGG + Intronic
1198228385 X:134667691-134667713 CAGTAAGATTACTTGAAGGCAGG + Intronic
1198259871 X:134956219-134956241 CAGAAGAATCACTTGAAGCCGGG - Intergenic
1199716533 X:150510939-150510961 CAGACAAGTTTCAGGAAGGCTGG + Intronic
1199758044 X:150883075-150883097 CAGGAAAATCACTTGAAGCCGGG + Intronic
1200306525 X:155031420-155031442 CAGGAAAATCACTTGAACGCGGG - Intronic
1200502769 Y:3971713-3971735 CAGGAAAATCACATGAACCCAGG - Intergenic
1200601843 Y:5215128-5215150 CAGAAAATTTAAATGAAGTTTGG - Intronic
1200608403 Y:5295467-5295489 CAGGAAAATTACTTGAACCCAGG - Intronic
1200665587 Y:6018229-6018251 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1200947490 Y:8860190-8860212 CAGGAAAATTGCTTGAAGTCGGG + Intergenic
1201309989 Y:12588277-12588299 CAGAAAAATCACTTGAACCCGGG + Intergenic
1201332111 Y:12835720-12835742 CAGTAAAATTGCTTGAAGCCGGG + Intronic
1201638660 Y:16154403-16154425 CAGGAAAATCACTTGAAGCCTGG + Intergenic
1201709685 Y:16976860-16976882 TTAAAAAATTACATGAAGGAAGG - Intergenic