ID: 1059116964

View in Genome Browser
Species Human (GRCh38)
Location 9:111608492-111608514
Sequence AAGCTACTCACCTGTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059116964_1059116966 6 Left 1059116964 9:111608492-111608514 CCAGTATTACAGGTGAGTAGCTT No data
Right 1059116966 9:111608521-111608543 TCTTTTTATTTCTTTCAGACAGG No data
1059116964_1059116967 7 Left 1059116964 9:111608492-111608514 CCAGTATTACAGGTGAGTAGCTT No data
Right 1059116967 9:111608522-111608544 CTTTTTATTTCTTTCAGACAGGG No data
1059116964_1059116968 26 Left 1059116964 9:111608492-111608514 CCAGTATTACAGGTGAGTAGCTT No data
Right 1059116968 9:111608541-111608563 AGGGTCTCACTCTGTTGCCCAGG 0: 4184
1: 22237
2: 70009
3: 146932
4: 263757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059116964 Original CRISPR AAGCTACTCACCTGTAATAC TGG (reversed) Intergenic
No off target data available for this crispr