ID: 1059123823

View in Genome Browser
Species Human (GRCh38)
Location 9:111664592-111664614
Sequence TATCCCACCACCAATGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059123814_1059123823 8 Left 1059123814 9:111664561-111664583 CCAAGGAAAGTCAGGTAACCTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1059123823 9:111664592-111664614 TATCCCACCACCAATGGCAGGGG No data
1059123819_1059123823 -10 Left 1059123819 9:111664579-111664601 CCTGGGTGGAGGTTATCCCACCA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1059123823 9:111664592-111664614 TATCCCACCACCAATGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059123823 Original CRISPR TATCCCACCACCAATGGCAG GGG Intronic
No off target data available for this crispr