ID: 1059124872

View in Genome Browser
Species Human (GRCh38)
Location 9:111674866-111674888
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 5, 1: 4, 2: 15, 3: 70, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059124872 Original CRISPR TCATATACACAGGTTCTGCA GGG (reversed) Intergenic
900492050 1:2955184-2955206 GCAAATACACAGGTTCCACATGG + Intergenic
901280727 1:8032644-8032666 TCCTATCAAAAGGTTCTGCAAGG - Intergenic
901395989 1:8981799-8981821 TCACATTCACAGGTTCTGGGGGG + Intergenic
902459943 1:16566801-16566823 TCAAATACTCAGATTCTTCATGG + Intronic
905332656 1:37217409-37217431 TAATATACACTGGTTTTGCAAGG + Intergenic
906235579 1:44206367-44206389 ACTTATGCACGGGTTCTGCAGGG + Intergenic
906359231 1:45138592-45138614 TCAAATAAGCAGGTTCCGCAGGG + Intronic
910861077 1:91742809-91742831 TCAAATACAAATGTTGTGCATGG - Intronic
913560374 1:120012889-120012911 TCATATGCTTAGGTTCAGCAAGG - Intronic
913637752 1:120780689-120780711 TCATATGCTTAGGTTCAGCAAGG + Intergenic
913989393 1:143596455-143596477 TCAAATACTCAGGTTGTTCATGG + Intergenic
914280961 1:146172297-146172319 TCATATGCTTAGGTTCAGCAAGG - Intronic
914542003 1:148623236-148623258 TCATATGCTTAGGTTCAGCAAGG - Intronic
914624638 1:149448008-149448030 TCATATGCTTAGGTTCAGCAAGG + Intergenic
917445266 1:175101666-175101688 TTCTACACACAGGTTCTCCAGGG + Intronic
917446220 1:175107824-175107846 TTCTACACACAGGTTCTCCAGGG + Intronic
918518674 1:185390269-185390291 TCAGATATACAGTTTCTTCATGG - Intergenic
919431739 1:197502569-197502591 TTATATATACATGTTCTCCATGG - Intergenic
919437065 1:197575099-197575121 TCAACTACACAGCTTCCGCATGG + Intronic
920537358 1:206747086-206747108 TCACATTCACAGGTACTGGAGGG + Intergenic
921384622 1:214556116-214556138 TCATGTACTTAGGTACTGCATGG - Intergenic
921497545 1:215859589-215859611 TCATATACATGGATTCTGCACGG + Intronic
921869845 1:220128179-220128201 TCATATATGCAGTTTCAGCAGGG + Intronic
922793297 1:228322601-228322623 TCATATATATAGGTTCTGCAGGG - Intronic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
1063620526 10:7643208-7643230 TCCAAGACCCAGGTTCTGCAGGG - Intronic
1065540822 10:26765505-26765527 TCATGTCCACTGGTTCTGTAGGG - Intronic
1067164224 10:43852489-43852511 CCTTACACACGGGTTCTGCAGGG - Intergenic
1067169067 10:43891082-43891104 TCCTAGAATCAGGTTCTGCAAGG + Intergenic
1067359367 10:45563335-45563357 TCTTAAAGACAGGTTCTGCTGGG + Intronic
1068545241 10:58337044-58337066 TCAAATACACTAGTTCAGCATGG - Intronic
1069677821 10:70261020-70261042 TTCTATACACAGGTTCTGCAAGG - Intronic
1070095984 10:73338813-73338835 TCCTATACATAGTTTCTACAGGG + Intronic
1070597477 10:77842713-77842735 CCATAGACACCGGTTCTGCATGG + Intronic
1071090182 10:81909338-81909360 TCACATTCACAGGTTCTGGGTGG + Intronic
1071320733 10:84454377-84454399 TCATATTCACAGGTTCTGGATGG + Intronic
1071727025 10:88209229-88209251 TCACATTCACAGGTTCTGGATGG - Intergenic
1071912331 10:90250386-90250408 TCATATACTCAGGCTTTCCAGGG + Intergenic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1073024428 10:100476716-100476738 ACATATACACATGATCTGCAGGG - Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1075076533 10:119354864-119354886 TCATATACTCAGGTTCTGTAGGG + Intronic
1075133534 10:119762017-119762039 TCATATACGGAGGTTCTACGGGG - Intronic
1075289923 10:121220231-121220253 TCATATACCTTGGTTCTGCAGGG - Intergenic
1075342024 10:121654684-121654706 TTGTATACACAGGTTCAACATGG + Intergenic
1075577738 10:123591275-123591297 TCATATACACAAGCTCTACAGGG + Intergenic
1076332655 10:129681715-129681737 TCATATACACAGAATCTACAGGG + Intronic
1078302853 11:10151077-10151099 ACATATAGACATGTTCTCCAAGG - Intronic
1080863033 11:36166949-36166971 TCACATACACAGGTGCTGGGTGG - Intronic
1081108852 11:39106820-39106842 TCACATTCTCAGGTTCTGGATGG + Intergenic
1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG + Intronic
1086124117 11:83332265-83332287 TCATAAAGACAGATTCTGAATGG - Intergenic
1087438945 11:98158628-98158650 TCATCTCCACAGCTTCTGCTTGG + Intergenic
1087657653 11:100944508-100944530 TCATATACAAAGGGTATACATGG - Intronic
1088295027 11:108283737-108283759 TCATATACGTGGGTTCTGCAGGG - Intronic
1088870014 11:113882779-113882801 TCCTATACGTGGGTTCTGCAGGG - Intergenic
1089562967 11:119354866-119354888 TCATATACGCAGGTTCTGCAGGG + Intergenic
1089597900 11:119593467-119593489 TCATCTGCTCAGTTTCTGCAAGG + Intergenic
1090742941 11:129682525-129682547 TCATATTCACAGTTTCAGCAGGG + Intergenic
1090776015 11:129966652-129966674 TTTTATACCCAGGTTCTGTAAGG - Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1094413601 12:30194016-30194038 TCATATACTGAGGTGCAGCAAGG - Intergenic
1095356141 12:41277829-41277851 TCACATACAGAGGTTCCGTATGG + Intronic
1097413545 12:59284499-59284521 TTACATTCACAGGTTCTGGATGG + Intergenic
1098081811 12:66794444-66794466 TCACATACACAGGGGCTCCAGGG + Intronic
1098266574 12:68727789-68727811 TCGTATATGCAGGTTCTGCAGGG - Intronic
1098350643 12:69555649-69555671 TCATACACACAGATTCCACAGGG + Intronic
1098427467 12:70381407-70381429 TCATGTACAAAGTTTCTGCATGG - Intronic
1098889070 12:75990120-75990142 TCAAAGACACTGGTTCTACATGG - Intergenic
1099030591 12:77521566-77521588 TCATACACACAGTTCCTACATGG + Intergenic
1099460380 12:82913883-82913905 TCCTATATTCTGGTTCTGCAGGG - Intronic
1099509870 12:83521094-83521116 TCAAACACAAGGGTTCTGCAAGG - Intergenic
1099967749 12:89468787-89468809 TCTTTTTCACAGGTTCTGCCTGG - Intronic
1100882329 12:99032638-99032660 TCACATTCACAGGTTCTACGTGG + Intronic
1101076775 12:101138217-101138239 TTGTATACACGAGTTCTGCAGGG + Intergenic
1101213631 12:102559779-102559801 TCATATATGCTGGTTCTGCAGGG + Intergenic
1101352648 12:103946318-103946340 TCATATACACGGGTTCCACAGGG - Intronic
1101502426 12:105316597-105316619 TCATATAAGCAGATTCTGCAGGG + Intronic
1102661858 12:114536151-114536173 TCACATTCACAGGTTCTGGGTGG - Intergenic
1102665826 12:114571872-114571894 TCACATTCACAGGTTCTGGGTGG + Intergenic
1104074899 12:125380409-125380431 TCATATTCACAGGTTCTGGATGG + Intronic
1104191534 12:126486209-126486231 TCACATATGCATGTTCTGCAGGG - Intergenic
1104358732 12:128112248-128112270 TCATATACACAGGGAGTGCAGGG + Intergenic
1106444622 13:29815935-29815957 TCAAATAACCAGTTTCTGCATGG + Intronic
1106815798 13:33405386-33405408 TCACACACACAGGGCCTGCAGGG + Intergenic
1107246087 13:38296139-38296161 TCATATAAAAAAGTTCTGTACGG + Intergenic
1107354515 13:39552615-39552637 TGATATTCAAAGGCTCTGCATGG + Intronic
1107774851 13:43827680-43827702 TGCTATACAGAAGTTCTGCAGGG + Intronic
1108149042 13:47512408-47512430 TCACATATACAGATTCTGGAGGG + Intergenic
1108270919 13:48758787-48758809 TCATATTCACAGGTTTTGGATGG - Intergenic
1109203906 13:59460642-59460664 TCATATTCTGAGGTTCTGTATGG + Intergenic
1111158814 13:84365885-84365907 TCATACATGCAGGTTCTGTACGG + Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1113252953 13:108474387-108474409 TCAGATACACAGGTTTCACATGG + Intergenic
1113360044 13:109622441-109622463 TCATATTCTGAGGTTCTGGATGG - Intergenic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1114766905 14:25382873-25382895 TCATATATACATATTCTGCCTGG - Intergenic
1114773840 14:25458700-25458722 TCACATAGACAGGTTCCTCAGGG - Intergenic
1115919155 14:38353738-38353760 ACATATATACAGGATCTGCATGG + Intergenic
1116425257 14:44782888-44782910 TCTTACACACAGACTCTGCAGGG - Intergenic
1116624128 14:47243200-47243222 TTAGACACACAGGTTCTCCAAGG - Intronic
1116679855 14:47953382-47953404 TTATATACACAGGTTCTATAGGG - Intergenic
1116960834 14:50966702-50966724 TCATATCCGCAGGTTCCACATGG - Intergenic
1117223711 14:53633602-53633624 TCATTTACAAGGGTTCAGCATGG - Intergenic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1118652473 14:67911966-67911988 TCATATACACAGCTATAGCAGGG - Intronic
1118741623 14:68743718-68743740 TCTTAAACGCATGTTCTGCACGG + Intergenic
1118963426 14:70556770-70556792 TCGTATACACAGGTTCTGCAGGG + Intergenic
1119907478 14:78318936-78318958 TGTTATACGCAGGTTCTGCGTGG + Intronic
1123719974 15:23051009-23051031 TCCTATACACAGTTTGTTCAGGG + Intergenic
1124242051 15:28037003-28037025 TCACATCCACAGATTCTCCAAGG + Intronic
1124636527 15:31368147-31368169 TCACATGCACAGGTTCTGGAGGG + Intronic
1124697806 15:31880708-31880730 TGATATTCACAGGTACTGAAGGG + Intergenic
1124822784 15:33063994-33064016 TCATTTACACAGTTTCTGCAGGG - Intronic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1131449040 15:92523891-92523913 TCATATTCACAGGTTCTCAGTGG - Intergenic
1134280944 16:12816545-12816567 TCAAATTCACAGGTTCTAGATGG - Intergenic
1135937053 16:26790243-26790265 AAATATACACATGCTCTGCATGG - Intergenic
1137713688 16:50584861-50584883 TCAGATACACAGGTGCTATAGGG - Intronic
1137941415 16:52691266-52691288 TCCTATACATAGGTTCCTCAGGG + Intergenic
1139108225 16:63855487-63855509 TCATATACACAAGTGAGGCAGGG + Intergenic
1144594067 17:16551461-16551483 TCATATACACAGGTTCCACCAGG + Exonic
1145267439 17:21386912-21386934 TCATATTCACAGGTTCTGTGTGG + Intronic
1149881449 17:60296257-60296279 TCACATACACAGGGACTTCAAGG - Intronic
1150844661 17:68643037-68643059 TCATTTAAACAGGTGCAGCATGG - Intergenic
1151405082 17:73881027-73881049 TCATATTCTGAGGTTCTGGATGG + Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1153600857 18:6780240-6780262 TGGTATCTACAGGTTCTGCATGG + Intronic
1154295623 18:13144446-13144468 TCCTACCCACGGGTTCTGCAGGG - Intergenic
1156612340 18:38739714-38739736 TCCTATACCCATGTTCTCCAGGG - Intergenic
1156708410 18:39912261-39912283 TCTCATACACAGGATCTGGATGG - Intergenic
1157352999 18:46907770-46907792 TCCTATACATGGGTTCTGCAGGG + Intronic
1157443450 18:47727489-47727511 TCAGATTCTGAGGTTCTGCATGG - Intergenic
1157672659 18:49543336-49543358 TCATATTTATGGGTTCTGCAGGG + Intergenic
1158824834 18:61206038-61206060 GCACATACACAGGATCTGAATGG - Intergenic
1159080669 18:63731787-63731809 TGATCCACACAGGTTCTGCAAGG - Intergenic
1160329950 18:77982229-77982251 TCATAGACACGGGTACTGGAGGG + Intergenic
1165404803 19:35622971-35622993 TCAGCTGCACAGCTTCTGCAGGG - Exonic
1166254159 19:41590325-41590347 TGGTAATCACAGGTTCTGCAGGG + Intronic
1166594973 19:44038385-44038407 TTATATACATTGGTTCTACAGGG + Intergenic
1167156793 19:47743507-47743529 TTATGTACCCAGGTTGTGCAAGG - Intergenic
1168488421 19:56785732-56785754 TCACATACACAGGTATTGGATGG + Intronic
1202676375 1_KI270711v1_random:10533-10555 TCAAATACTCAGATTCTTCATGG + Intergenic
925007479 2:455267-455289 TCACACAAGCAGGTTCTGCAGGG - Intergenic
925260694 2:2525981-2526003 TGATATACACAGGTTCACCAAGG + Intergenic
926536770 2:14122777-14122799 TCATATCCAGAGGTTCTGAAGGG - Intergenic
928011636 2:27613610-27613632 TCATATACACAGCCTTGGCAGGG - Intronic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
929510431 2:42562261-42562283 TCATATTCGCAGGTTCTGGGTGG + Intronic
929727734 2:44448175-44448197 TCATATATGCAGTTTCTGCAGGG - Intronic
929752496 2:44730261-44730283 TCTTACACACAGGATCTGGATGG - Intronic
929849002 2:45564834-45564856 TCATATACATGGGTTCTGCAGGG + Intronic
930289136 2:49471456-49471478 TCATATACGCAGGCTCTGAAGGG + Intergenic
932115931 2:69047113-69047135 TAGTATATGCAGGTTCTGCAGGG + Intronic
932223035 2:70015484-70015506 TCATATACAGAGGTTTCGCAGGG + Intergenic
932844223 2:75118862-75118884 ACATGTTCACAGGTTCTGTATGG + Intronic
935169148 2:100597056-100597078 TCGTATAGGCAGGTTCTGCAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936226180 2:110654939-110654961 CCATATCCACAAGTTCTGCAGGG + Intronic
936615116 2:114040509-114040531 TCATATTCTGAGGTTCTGGATGG + Intergenic
937597105 2:123685763-123685785 TTAGACACACAGGTTCTCCAAGG - Intergenic
939806662 2:146782185-146782207 TCACATTCACAGGTTCTGGGCGG - Intergenic
940683880 2:156821833-156821855 TCATTTACAGAGGTTCTTGAAGG + Intergenic
940760431 2:157733050-157733072 TCCTATGCAAGGGTTCTGCAAGG + Intergenic
941187563 2:162335569-162335591 GCATATAGACAGTTTCTCCAAGG - Intronic
942784987 2:179690402-179690424 CCTTATATACAAGTTCTGCAGGG - Intronic
943477441 2:188375957-188375979 TCATATATACGGGTTCCGCATGG - Intronic
943533856 2:189122423-189122445 TCATATACATAGCTTCAGGAGGG + Intronic
943797492 2:192015089-192015111 TCTGATACACATGTTCTGCCTGG + Intronic
944027077 2:195183205-195183227 TCATATAGGCAGTTTCTGCCTGG + Intergenic
944443871 2:199769808-199769830 TCATTTACACAGGTGTTGCCAGG - Intronic
944812338 2:203339900-203339922 TCATATACACGCGTTCCACAAGG - Intronic
946357975 2:219201035-219201057 TTCCACACACAGGTTCTGCAAGG + Intronic
946911018 2:224460807-224460829 TTGTATACACAGGTTCCACAGGG - Intergenic
1169832048 20:9836273-9836295 TCATATTCACAGGTTCTGGATGG - Intronic
1170328391 20:15181114-15181136 TTCTATACTCGGGTTCTGCAGGG - Intronic
1172370774 20:34389072-34389094 TCACATACGCAGGTTCCACAGGG - Intronic
1172659932 20:36560896-36560918 TCATATACAAATATTTTGCATGG + Intergenic
1173195791 20:40911780-40911802 TTGGATACACAGGTTCTCCAAGG - Intergenic
1173691466 20:44964432-44964454 TCGTTTCCATAGGTTCTGCAGGG - Intergenic
1173895371 20:46546564-46546586 TCACATCCTCAGGTACTGCATGG - Intronic
1175060708 20:56239720-56239742 CCATAGAGACAGGTTTTGCAAGG - Intergenic
1175289076 20:57861494-57861516 TCATATCCACAGGTTCCCCCAGG - Intergenic
1175625846 20:60487644-60487666 ACATAGACATAGGGTCTGCAGGG + Intergenic
1176187589 20:63789603-63789625 ACAGATACACAGGGTCTCCAAGG + Intronic
1176689531 21:9887449-9887471 TCCTATAAACAGGTTCCACAGGG - Intergenic
1177262253 21:18745675-18745697 TAATATACATAATTTCTGCAAGG - Intergenic
1178952781 21:36998809-36998831 TCACATTCACAGGTTCTGGGGGG + Intergenic
1179268878 21:39832630-39832652 TCACATTCACAGATTCTGAATGG - Intergenic
1182382623 22:29905225-29905247 TCATATAGGCAGGTTCCACAGGG - Intronic
949124246 3:426802-426824 TCATAGCCACAAGTTATGCATGG - Intergenic
950535114 3:13574209-13574231 TCACACACGCAGGTTCTGCAGGG - Intronic
950839420 3:15952549-15952571 TGTTCTACACAGGTTCTGAAAGG - Intergenic
951146810 3:19236724-19236746 TCATTTACACATGTTCTACATGG - Intronic
951615716 3:24541258-24541280 TTGTATCCACAGGTTCTGCAAGG - Intergenic
951705453 3:25539983-25540005 TCGTACACACAGGTTCTGCAGGG + Intronic
951725263 3:25750890-25750912 TTATATACATGGGTTCTGCAGGG - Intronic
954229315 3:49204328-49204350 TCATATATACTAGTTCTGCAGGG + Intronic
955425851 3:58788912-58788934 TCATATATGTGGGTTCTGCATGG - Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
956677318 3:71748287-71748309 TCATATATATGGGTTCTGCAGGG + Intronic
957518711 3:81290871-81290893 TCACATATGAAGGTTCTGCAGGG - Intergenic
958671100 3:97205583-97205605 TCATATGCACAGGTTTCACAGGG + Intronic
958916231 3:100053591-100053613 TCACATTCACAGGTTTTGCTAGG + Intronic
959153844 3:102641914-102641936 TTATATACAGAGGGTCTGCAGGG + Intergenic
960085409 3:113585169-113585191 TCACATAAACAGATTCTGAAGGG - Exonic
961318809 3:126058370-126058392 TCATATACCCAGGCTCTGGTAGG + Intronic
963190028 3:142459709-142459731 TCATACATGCAGGTTCTGCAGGG + Intronic
963607761 3:147425598-147425620 TTTTATACACAGGTTCTTCCAGG - Intronic
963739153 3:149057500-149057522 TCATATATACTCGTCCTGCAGGG + Intronic
964365897 3:155950635-155950657 TCATATACCCAGATTCTTCAGGG + Intergenic
965604700 3:170486358-170486380 TCATCCACACAGGTGCTGCAAGG - Exonic
966275812 3:178166920-178166942 TCATATACACAGTTTTTTTAGGG - Intergenic
969947814 4:10802411-10802433 TCATATTCAGAGGTTCTGAGCGG - Intergenic
970162104 4:13199284-13199306 TCATACCCATGGGTTCTGCAGGG - Intergenic
970173834 4:13316646-13316668 TCAAACAAACACGTTCTGCATGG - Intergenic
970564283 4:17316239-17316261 TCATATTCCCAGGTTCCACATGG + Intergenic
971238417 4:24864889-24864911 TTGTATTCACAGGTTCTGCAGGG + Intronic
972144612 4:36007215-36007237 TCATATTCACAGGTTCTAGGTGG - Intronic
973634574 4:52850175-52850197 TCATAAGCAAAGGCTCTGCAAGG - Intergenic
975224066 4:71849135-71849157 GCATATTCACAGGCTCTGCAGGG + Intergenic
975499803 4:75072081-75072103 TCACATACCCAGATTCTGCATGG - Intergenic
979118244 4:116856019-116856041 CCATATACACAGGTTCTGATAGG + Intergenic
980243393 4:130204568-130204590 TAATATACAAGGGTTCTGTAGGG + Intergenic
980352933 4:131705307-131705329 TCCTATAAACAGGTTCCACAGGG - Intergenic
980561987 4:134489908-134489930 TCATTTACATTGGTTCTGAATGG - Intergenic
981114955 4:140979094-140979116 TTGTATACACAGGTTCCTCAGGG - Intronic
983744429 4:171178566-171178588 TCATATCCACAGGTTCTACGTGG + Intergenic
985110187 4:186540287-186540309 ACATATTCACAGGGTCTGCAGGG - Intronic
986112790 5:4736708-4736730 TCCTATTCACACGTTCAGCAAGG + Intergenic
986173300 5:5331251-5331273 TCCTACAGGCAGGTTCTGCATGG + Intergenic
986719027 5:10546739-10546761 TCACATTCACAGGTTCTGGGTGG + Intergenic
986977523 5:13410580-13410602 GCAGATACCCCGGTTCTGCAAGG - Intergenic
990909189 5:60837066-60837088 TCATATGCACAGGTACAGAAAGG - Intronic
991075352 5:62530316-62530338 ACATATACACAGGTTCCGCAGGG - Intronic
991954560 5:71980014-71980036 TCCTATACGTGGGTTCTGCAGGG + Intergenic
992263879 5:74998047-74998069 TCATATATGTGGGTTCTGCAGGG - Intergenic
992607072 5:78468985-78469007 TTGTATACATGGGTTCTGCAGGG - Intronic
992887087 5:81169648-81169670 TAACCTTCACAGGTTCTGCATGG + Intronic
994497285 5:100529455-100529477 TCTAATACACAGAGTCTGCAAGG - Intergenic
996290288 5:121844675-121844697 TCACATTCACAGGTTCTGGATGG + Intergenic
997709776 5:135994328-135994350 ACATATAAATAGGTTCTGCGAGG + Intergenic
999027286 5:148248567-148248589 TGATATACACAGGCTGGGCATGG - Intergenic
999408652 5:151329941-151329963 TCATATACTCAGGTTCTGCAGGG + Intronic
999773311 5:154791716-154791738 TCATATATGTAGGTCCTGCAGGG - Intronic
1001361682 5:171091936-171091958 TCATATATGCAGGTTCCACAGGG + Intronic
1002654892 5:180738254-180738276 TCATAAACAGAGGTACTTCAAGG - Intergenic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003363349 6:5449978-5450000 TCATACACACAGGTTCCTCAGGG - Intronic
1003520300 6:6852914-6852936 TCACGTACTCAGGTTCTGCAGGG - Intergenic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1004287841 6:14339234-14339256 TCATATGCACATATTCTTCATGG - Intergenic
1004486717 6:16073128-16073150 TCATATATGCAGGTTCCTCAGGG - Intergenic
1004651563 6:17614568-17614590 TGGTATACTCAGGTTCTGCAGGG + Intergenic
1005004032 6:21270293-21270315 TCATATTCACAAGTTCTGGTGGG + Intergenic
1005333617 6:24772280-24772302 TAATATACTCAGGATCTTCAGGG - Intergenic
1008004797 6:46399875-46399897 TCACATTCACAGGTTCTGGATGG + Intronic
1009651843 6:66486140-66486162 TGGTATACCCAGTTTCTGCAAGG - Intergenic
1009738661 6:67714318-67714340 CCATAGACACATGTACTGCAAGG + Intergenic
1009833743 6:68971385-68971407 TCCAACACACAGATTCTGCAGGG - Intronic
1010059974 6:71611240-71611262 TTATATATATATGTTCTGCAGGG + Intergenic
1011198242 6:84804847-84804869 TCACATGCACAGGTTCTGGGTGG + Intergenic
1011246653 6:85326842-85326864 TTCTACACACAGGTTCTCCAAGG - Intergenic
1015716932 6:136202468-136202490 TCATATTCTGAGGTTCTGGATGG + Intergenic
1017049881 6:150380624-150380646 CCATAGACACAGGTTCTGTGGGG - Intronic
1017134008 6:151132485-151132507 TCACATTCACAGGTTCTGGGTGG - Intergenic
1018146659 6:160897896-160897918 TCACATTCAAAGGTTCTGGAGGG - Intergenic
1018773510 6:166993151-166993173 TCATATCCACAGGTTCCACAGGG + Intergenic
1019218016 6:170455928-170455950 TCATCTACACAGATTCTGTAGGG - Intergenic
1020464749 7:8464873-8464895 TCATATGCCCATGTTCTGGAAGG + Intronic
1020681587 7:11243850-11243872 TAATATCCACAATTTCTGCAAGG - Intergenic
1021661385 7:22921747-22921769 TTGTATATGCAGGTTCTGCAAGG - Intergenic
1023686145 7:42737503-42737525 TCACACACACAGGTTATGAAGGG + Intergenic
1025173479 7:56782617-56782639 TCATATATCCAGGTTTTGCAGGG + Intergenic
1025698624 7:63795554-63795576 TCATATATCCAGGTTCTGCAGGG - Intergenic
1030087280 7:105827595-105827617 TCATATATTCGGGTTCCGCAAGG + Intronic
1030203090 7:106925558-106925580 TCATGTATCCAGGTTCTGCAAGG + Intergenic
1031978590 7:128109378-128109400 ACATATACACAGCTGCTGCTGGG - Intergenic
1032562798 7:132910108-132910130 TTCTATCCACAAGTTCTGCAGGG + Intronic
1032644468 7:133807092-133807114 TCATATACGCAGGTTCTGCAGGG + Intronic
1033289654 7:140072485-140072507 TCACATTCATAGGTTCTGGATGG - Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1034632035 7:152538651-152538673 TAAGACACACAGGTTCTCCAAGG + Intergenic
1035011694 7:155723840-155723862 GCATATACACATGTTGTACAAGG - Intronic
1036069905 8:5429846-5429868 TCATATCCATTGATTCTGCAGGG - Intergenic
1036774479 8:11600887-11600909 TCATAAACACAGGCTCTTTAGGG - Intergenic
1038514860 8:28179112-28179134 TCATAGACGCAGCTTCTGCAGGG + Intronic
1038718772 8:30014797-30014819 TAATATACACAGGCTTGGCATGG + Intergenic
1040045145 8:42955274-42955296 TCACATAGGGAGGTTCTGCAGGG + Intronic
1040906470 8:52474271-52474293 TCTTGTGCACAGGGTCTGCAAGG + Intergenic
1041272191 8:56120240-56120262 TCATATGCACAAGTTCTGGATGG + Intergenic
1041766946 8:61428762-61428784 TCTTGTACAAAGGTTCTGCAGGG - Intronic
1045755955 8:105542607-105542629 TTGTATCCACAGGTTCTTCAGGG + Intronic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1046804731 8:118467531-118467553 TCATGGCCACATGTTCTGCAGGG - Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049052385 8:140208909-140208931 TCATATGCAGGGGTTCTGCAGGG + Intronic
1049946323 9:599761-599783 TCATATACGCAGGTTCTTCAGGG + Intronic
1050007984 9:1154535-1154557 TCAAATATGTAGGTTCTGCAGGG - Intergenic
1051054661 9:12970753-12970775 TCACATACACAGGTTGTGGGTGG + Intergenic
1052703747 9:31969403-31969425 TAAGAAACACAGGCTCTGCATGG + Intergenic
1053354127 9:37432175-37432197 TCAAAAACACTGGTCCTGCAGGG - Intronic
1053779732 9:41594036-41594058 TCCTATAAACAGGTTCCACAGGG + Intergenic
1054167688 9:61804277-61804299 TCCTATAAACAGGTTCCACAGGG + Intergenic
1054669858 9:67776629-67776651 TCCTATAAACAGGTTCCACAGGG - Intergenic
1054840582 9:69734304-69734326 TTATATCCAAAGGTTCTACATGG + Intronic
1055222741 9:73957044-73957066 TCATATCCACAGGCTCTTCAGGG - Intergenic
1058844249 9:108940189-108940211 TCATATACTCAGGTTCCAAAGGG + Exonic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059176300 9:112172889-112172911 TCATAAAACCAGGTTCTCCAAGG + Intronic
1060652859 9:125345081-125345103 TCACATACACAGTTTCCACAGGG - Intronic
1061779321 9:132986509-132986531 TCACATTCACAGGTTCTGGGTGG + Intronic
1186925325 X:14327402-14327424 TCATACAGGCAGGTTCTGCAGGG + Intergenic
1187196720 X:17093273-17093295 TCACACACACAGCTTCTGCAAGG - Intronic
1187827368 X:23345463-23345485 GGATATACAAAGGTTCAGCAAGG - Intronic
1187846012 X:23538626-23538648 TAGTATACACGGGTTCTGCAGGG - Intergenic
1187905801 X:24065322-24065344 ACATATACACAGGCTGGGCATGG + Intronic
1187931924 X:24301553-24301575 TCATATACTTGGGTTCTGCAGGG - Intergenic
1189763797 X:44348609-44348631 TTGTATACATAGGTTCTCCAAGG + Intergenic
1189922290 X:45914421-45914443 TCATATACGTGGGTTCTGTAGGG + Intergenic
1190390908 X:49930687-49930709 TCCTATATGCAGGTTCTGTAAGG - Intronic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1192305327 X:69953010-69953032 TCATACACCCAAGTTCTACAAGG - Intronic
1192602644 X:72481085-72481107 TAATTTATAGAGGTTCTGCAGGG + Intronic
1193824025 X:86200540-86200562 TCTAATACACAGGGTCTACAAGG + Intronic
1194855327 X:98920481-98920503 TCATATGCACAGGTTGTGGGTGG - Intergenic
1195004862 X:100676028-100676050 TCATAAACCCAGCTTCTGCTTGG + Exonic
1195672818 X:107483895-107483917 ACATATACACTGGGTGTGCAAGG + Intergenic
1196316627 X:114233733-114233755 ACCTGTACACAGGTTCTGAAGGG - Intergenic
1196714760 X:118800070-118800092 TTGGATACACAGGTTCTCCAAGG - Intergenic
1197361463 X:125509052-125509074 TCATGTCTACAGGTTCTGCAGGG + Intergenic
1197694382 X:129535273-129535295 TCATATACACAAATCCAGCATGG - Intergenic