ID: 1059127622

View in Genome Browser
Species Human (GRCh38)
Location 9:111708113-111708135
Sequence TTGCGTGTATATATAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059127620_1059127622 -5 Left 1059127620 9:111708095-111708117 CCATAACCAATATTTCTCTTGCG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1059127622 9:111708113-111708135 TTGCGTGTATATATAGAGCATGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059127622 Original CRISPR TTGCGTGTATATATAGAGCA TGG Intronic
902129834 1:14250294-14250316 ATGAGTGTATTTATAGAGCTTGG - Intergenic
903562946 1:24242429-24242451 TTGCATGTATAAATAGCTCACGG + Intergenic
904187492 1:28716780-28716802 TTGTTTGTATATTTAGAGCTGGG + Intronic
904667690 1:32135833-32135855 TTTGGTGTATTTATAGAGCTGGG - Intronic
904755696 1:32767343-32767365 GTTTGTGTATATACAGAGCAGGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907983660 1:59509186-59509208 TTGCGTGGATATAGGAAGCATGG - Intronic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
911862014 1:102963470-102963492 TTTCATGTATAAATAGAGGATGG + Intronic
916048086 1:161015698-161015720 TTGCTTATATATATATATCATGG - Intronic
919361285 1:196598444-196598466 TTGCCTCTAGATGTAGAGCATGG - Intronic
920228265 1:204453617-204453639 TTCCCTTTATATATAGAGAAGGG - Intronic
1068534613 10:58228253-58228275 TTTCATGTATAAATATAGCATGG - Intronic
1069238669 10:66110497-66110519 GTGTGTGTATATATAGAGAGAGG - Intronic
1071054286 10:81491131-81491153 GTGTGTGTATATATATATCATGG - Intergenic
1072233881 10:93436893-93436915 TTCCATGAAAATATAGAGCAAGG - Intronic
1075352798 10:121739670-121739692 TTGCATGCATATAGAGAGCGTGG - Intergenic
1079634451 11:22718296-22718318 TTGTGTGTATATATGTATCATGG + Intronic
1088914748 11:114219076-114219098 GTGCGTGTATATGTATAGCGGGG + Intronic
1094462479 12:30712009-30712031 TTTGGTGTATAAATAGAGCAAGG - Intronic
1096942664 12:55364676-55364698 ATATGTGTATATATAGAGAAAGG + Intergenic
1100155819 12:91799113-91799135 ATGTGTGTATATATAGGGGATGG - Intergenic
1101291374 12:103373117-103373139 GTGCTTTCATATATAGAGCATGG - Intronic
1102642119 12:114376111-114376133 TTGGGTGTATATCTAGAAGAGGG - Intronic
1105620549 13:22061782-22061804 TTGTGAGTATATATACAGCATGG + Intergenic
1111151472 13:84259654-84259676 GTGTGTGTATATATATATCAAGG - Intergenic
1112177472 13:97041283-97041305 TTCAATGTATTTATAGAGCAGGG - Intergenic
1112979616 13:105366839-105366861 TTGTGTGTATATATATAAAATGG - Intergenic
1114652447 14:24294280-24294302 TTCTGTGTATATAAAGAGCAGGG + Intronic
1116342532 14:43742930-43742952 TTGCATTTATAAATAGAGCATGG - Intergenic
1119982779 14:79101133-79101155 TTGGCTGTATATCAAGAGCAAGG - Intronic
1125053471 15:35329297-35329319 TTGTGTGTATATAGAATGCAGGG + Intronic
1125337444 15:38640978-38641000 TTGTGTGTATATATACTACAAGG + Intergenic
1125926824 15:43569551-43569573 ATGCCTATATTTATAGAGCAAGG + Intronic
1125939968 15:43669116-43669138 ATGCCTATATTTATAGAGCAAGG + Intergenic
1129795579 15:78373806-78373828 GTGTGTGTATATATAGAGATGGG + Intergenic
1129889208 15:79059728-79059750 GTGTGTGTTTATATACAGCAAGG - Intronic
1130745152 15:86645283-86645305 TTGTGTGTGTAAAAAGAGCAGGG + Intronic
1131926354 15:97388246-97388268 TTGCGTTTATAAATAGTCCAAGG + Intergenic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1133796240 16:9048873-9048895 GTGTGTGTATATATATAGAATGG + Intergenic
1136568923 16:31085401-31085423 TTGCCTGTAGTTACAGAGCAAGG - Intronic
1140609116 16:76577053-76577075 TTGCTTGTTTGTATAGAGGAAGG + Intronic
1141545542 16:84765628-84765650 TGGTGTGTATATATAGACAAGGG - Intronic
1148960966 17:51392469-51392491 GTGTGTGTATATCTGGAGCAGGG + Intergenic
1156770941 18:40724119-40724141 TTGGAAGTATATATATAGCATGG - Intergenic
1158022271 18:52857274-52857296 TAGCATGTATCTTTAGAGCAAGG - Intronic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1167438940 19:49497081-49497103 TTGCAAGTAAATGTAGAGCATGG + Intronic
925112553 2:1348510-1348532 TTGAGTGTATATAAAGACCTGGG - Intronic
930107654 2:47652753-47652775 TTGCATTTATTAATAGAGCAGGG + Intergenic
930617756 2:53611364-53611386 TAGCTTGTCTATACAGAGCATGG - Intronic
936461478 2:112717428-112717450 ATGTGTGTTCATATAGAGCAGGG - Intergenic
941269749 2:163410240-163410262 TTGTGTGTAGACATAGAGCTGGG + Intergenic
941448221 2:165627944-165627966 TTGCTGGGATATATATAGCAGGG - Intronic
943539141 2:189189953-189189975 TTGCATGTATATTTAGTGTATGG - Intergenic
943867824 2:192951494-192951516 GTGCGTGTATATATAAATCTCGG + Intergenic
945213811 2:207412324-207412346 TTGAGTGTATAAAGAGAGGAGGG - Intergenic
948972495 2:241440274-241440296 TGGCGTGTGTATATATAGTAAGG + Intronic
1170113311 20:12828846-12828868 ATGTGTGTATATATAGAGTGTGG + Intergenic
1173913223 20:46686232-46686254 TCACGTGTATATATAGACCAAGG - Exonic
1175965619 20:62658734-62658756 TTCCGTGTAGATATTCAGCAGGG - Exonic
1182978570 22:34646655-34646677 TTGCTTGTAAATATGGACCATGG - Intergenic
1184375715 22:44111355-44111377 ATGCCTGTATAAATACAGCATGG - Intronic
1184825966 22:46951183-46951205 TTGAGTGTATGTATAGTGCTGGG + Intronic
950702141 3:14757983-14758005 TGGTGTGAATATTTAGAGCACGG + Intronic
950868274 3:16207090-16207112 TGGGGTCTATATTTAGAGCAAGG - Intronic
957831843 3:85531728-85531750 TTTCGTTTATTTATAGATCATGG - Intronic
960804063 3:121565835-121565857 ATGTGTGTATATATATAGCTGGG + Intergenic
965880120 3:173379131-173379153 ATGCGTGTATATATACATAATGG - Intergenic
968016657 3:195341145-195341167 TTGCGTGTTTCTATATATCATGG - Intronic
970575889 4:17427309-17427331 TTGCGTGTGTATGTAGAGATGGG + Intergenic
971429429 4:26549229-26549251 TTGCTTGTGTATATTGAGAATGG + Intergenic
971843429 4:31886393-31886415 TTCCATATATATATATAGCAGGG - Intergenic
975248232 4:72145159-72145181 TTGTGTGTATATATTCAGGAAGG - Intronic
975601974 4:76110542-76110564 TTGCATGTATATACAGAAAATGG + Intronic
977513467 4:97991261-97991283 GTGTGTGTATATATACACCATGG - Intronic
978211098 4:106136186-106136208 TTGCATGTATTTATAGACCAAGG - Intronic
984489956 4:180421218-180421240 TTAAGTGAATATATAGTGCAAGG - Intergenic
984993181 4:185401697-185401719 TTGTGTATACAAATAGAGCAAGG + Intronic
990652255 5:57914617-57914639 TTGTGTCTATATATAGAGAGAGG + Intergenic
994925209 5:106108480-106108502 TTGCCTGTATAAATTTAGCATGG - Intergenic
995810413 5:116101101-116101123 TGGTGTGTATATATAGACAATGG - Intronic
996816765 5:127582839-127582861 CTACTTCTATATATAGAGCATGG + Intergenic
1002629800 5:180564293-180564315 TTGAATGTGTATATAGAACATGG + Intronic
1002826253 6:777006-777028 TTATGTGTATATATAGTACATGG - Intergenic
1005189174 6:23200085-23200107 TTTAGTGCATATATAGACCAAGG - Intergenic
1005948356 6:30612111-30612133 ATGTGTGTATATATAGAGAGAGG - Intronic
1010510321 6:76710220-76710242 TAGTTTGTATATATTGAGCATGG - Intergenic
1015085208 6:129282553-129282575 CTGTGTGTATATGTTGAGCAAGG + Intronic
1015592792 6:134838594-134838616 GTGTGTGTATATATATATCATGG - Intergenic
1016748582 6:147608280-147608302 TTTTGTGTATATACACAGCAGGG - Intronic
1018476951 6:164151732-164151754 CTGCTTGTATTTATAGAACAAGG + Intergenic
1018836887 6:167491965-167491987 AAGCGTGTATCTATAAAGCACGG - Intergenic
1027835158 7:83232356-83232378 GTGCAGGTATATATAGATCAAGG - Intergenic
1028701490 7:93786042-93786064 TATAGTGTATATATATAGCAAGG + Intronic
1030584492 7:111400654-111400676 TTGTGTGTAGATATACTGCATGG + Intronic
1036445551 8:8819230-8819252 TTGCATGTATATAATGAGTAGGG - Intronic
1041415236 8:57600608-57600630 ATGAGTGTATATATATAACAGGG + Intergenic
1042529388 8:69798957-69798979 TTGCTTGTCTATATATTGCAGGG + Intronic
1045652644 8:104355592-104355614 GTGTGTGTATATATAGAGAGAGG + Intronic
1046556040 8:115774688-115774710 TTGCTTGTTTAGATACAGCATGG + Intronic
1046800412 8:118420291-118420313 TTGTGTGTGTATATATAGGAGGG + Intronic
1051988412 9:23120023-23120045 TTGAGTGAATATATAGAATATGG + Intergenic
1057674148 9:97123694-97123716 TTGTGGGTATGTATAAAGCAGGG + Intergenic
1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG + Intronic
1059127622 9:111708113-111708135 TTGCGTGTATATATAGAGCATGG + Intronic
1059661966 9:116410447-116410469 GTGCGTGTATGTATAGATAAAGG - Intergenic
1186059348 X:5687180-5687202 ATACATGTATATATAGAGAAAGG + Intergenic
1186604257 X:11073163-11073185 ATAGATGTATATATAGAGCAAGG - Intergenic
1188158720 X:26774765-26774787 TTTGGTGTATATATACACCATGG + Intergenic
1189264671 X:39704985-39705007 TTGGATATATATATACAGCATGG - Intergenic
1191102694 X:56749362-56749384 TTGCTTATATATATATAGAATGG - Intergenic
1194307341 X:92264517-92264539 TTATGTGTATATTTAGAGAAAGG + Intronic
1199579953 X:149351128-149351150 TTGGGTGAATATACAGAGCCTGG + Intergenic