ID: 1059130865

View in Genome Browser
Species Human (GRCh38)
Location 9:111748186-111748208
Sequence CTTGTTAGTAAGATCTGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059130861_1059130865 -2 Left 1059130861 9:111748165-111748187 CCCGATATCCTCAATTCCATGCT 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 197
1059130863_1059130865 -10 Left 1059130863 9:111748173-111748195 CCTCAATTCCATGCTTGTTAGTA 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 197
1059130860_1059130865 -1 Left 1059130860 9:111748164-111748186 CCCCGATATCCTCAATTCCATGC 0: 1
1: 0
2: 0
3: 30
4: 2181
Right 1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 197
1059130862_1059130865 -3 Left 1059130862 9:111748166-111748188 CCGATATCCTCAATTCCATGCTT 0: 1
1: 0
2: 3
3: 14
4: 234
Right 1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059130865 Original CRISPR CTTGTTAGTAAGATCTGAAA AGG Exonic
902054965 1:13592991-13593013 CTTTGTAGTAAGTTTTGAAATGG + Intronic
904091668 1:27949305-27949327 CTTGTTAGGAAGGTGAGAAATGG - Intronic
904892138 1:33787499-33787521 CTTTTCAGGAACATCTGAAAGGG - Intronic
905141439 1:35848341-35848363 CTTATAAGTAGGAGCTGAAAAGG - Intronic
906278571 1:44536900-44536922 CTTGTTAGCATGATATGAAATGG + Intronic
907744852 1:57202986-57203008 CATGTTAGTAACTCCTGAAAGGG + Intronic
908110464 1:60892058-60892080 CTTGGATGTAAGATGTGAAATGG + Intronic
908736836 1:67285335-67285357 CTTGGGAGTCTGATCTGAAAAGG - Intergenic
915274062 1:154776007-154776029 ATTGTAAGTAAGAGCTGAAGGGG + Intronic
917900179 1:179534481-179534503 CTTCTTAGTAAAATCTGATTTGG - Intronic
919049487 1:192496410-192496432 CTTTTTATTAAGTTTTGAAATGG - Intergenic
920437755 1:205959137-205959159 CTTAAGAGAAAGATCTGAAAGGG - Intergenic
922398174 1:225224046-225224068 CTGGTCAGTAAGATCTCAAAAGG + Intronic
923693333 1:236219718-236219740 CTTGTTATTAAGATGGGAAATGG + Intronic
1064450414 10:15437025-15437047 CTTGCCAGCAAGATGTGAAAAGG - Intergenic
1064697782 10:17985604-17985626 CTTGTTAGTAATTTCTAAATAGG + Intronic
1067394504 10:45901672-45901694 CATGTTAATAAGTGCTGAAATGG + Intergenic
1067862827 10:49870803-49870825 CATGTTAATAAGTGCTGAAATGG + Intronic
1071579830 10:86758574-86758596 AATGTTAATAAGATTTGAAAAGG - Intronic
1071739921 10:88346358-88346380 ATTGTCAGTAAAACCTGAAAAGG - Intronic
1071752839 10:88500804-88500826 CTTGTGAGTAATCTCTTAAAGGG - Intronic
1071770514 10:88724335-88724357 CTTTTTAGTAAGAAAAGAAAAGG - Intergenic
1071835920 10:89416606-89416628 TTTGGTTGTAAGATCTCAAAGGG - Intronic
1074128924 10:110555853-110555875 CTTGTTACAAGCATCTGAAAAGG + Intergenic
1078852539 11:15177927-15177949 ATTGCTAGTGAGCTCTGAAAAGG - Intronic
1079790947 11:24738840-24738862 ATTCGTAGTAAGAGCTGAAACGG - Intronic
1085484569 11:76851108-76851130 ATTGTTAGAAAGATTTTAAAAGG + Intergenic
1085794597 11:79526892-79526914 CTTTGTAGTAAGTTTTGAAATGG + Intergenic
1086444996 11:86862044-86862066 ATTGTTTGTAACATCTGGAAGGG + Intronic
1087254286 11:95937052-95937074 CTAGTCAGTAAGAACTCAAAAGG + Intergenic
1087549763 11:99634334-99634356 CTTGTTAGTAATATGTGCACTGG - Intronic
1088021205 11:105121803-105121825 TTAATTAGTAAGATCTGAACTGG - Intergenic
1090811524 11:130248801-130248823 CTTGTTAATAACATCATAAAGGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093337772 12:17929650-17929672 CTTGATAATAGTATCTGAAAAGG - Intergenic
1093363407 12:18260949-18260971 ATTTTTAATAACATCTGAAAAGG - Intronic
1097644210 12:62216683-62216705 CTTATTGGAAAGATCAGAAATGG + Intronic
1099927524 12:89035844-89035866 ATTGTTAGTAAAATTTTAAAAGG - Intergenic
1100880210 12:99008080-99008102 CTTCTTATTAAGTCCTGAAAAGG + Intronic
1100981122 12:100163430-100163452 CTGGTCAGTAAGACCTCAAAAGG - Intergenic
1101311117 12:103580263-103580285 GTTGTTAGTAGGAACTGACAGGG - Intergenic
1102541610 12:113623653-113623675 CTTGTTATTAACATCTTAAATGG + Intergenic
1102789758 12:115635159-115635181 CTAGAAAGTAAGATCTGAGAAGG + Intergenic
1106601337 13:31189571-31189593 CTTGTGAGTAGCATCTGAAGTGG + Intergenic
1108677763 13:52752178-52752200 CTTGTTTGTACCATCTTAAAAGG + Intergenic
1108786563 13:53910005-53910027 CTTGTTACTGTGGTCTGAAAAGG + Intergenic
1108975420 13:56438088-56438110 ATTGTTTGTAAGATCTGTGATGG - Intergenic
1109011613 13:56955627-56955649 CGTGTTTATAAGATCTTAAAAGG - Intergenic
1111097139 13:83531604-83531626 CTTCTGAGTCAGTTCTGAAAAGG - Intergenic
1112660443 13:101501665-101501687 TTTGATAGAAAGATCTGTAAGGG + Intronic
1114992895 14:28310570-28310592 CATGTTAGTAAAAACTGAGAAGG - Intergenic
1114998187 14:28386626-28386648 CTTATGAGTAAGATCTGAAAAGG - Intergenic
1115693500 14:35872018-35872040 CTTGTAAGAAAGATTTGAATTGG + Intronic
1116317888 14:43420547-43420569 CTTGAAATTAAGATCTGAACTGG - Intergenic
1118274112 14:64370470-64370492 CTTTGTAGTAAGTTTTGAAATGG - Intergenic
1118902552 14:69998919-69998941 CCTGTGAGTTAAATCTGAAAGGG + Intronic
1119580745 14:75777804-75777826 CATGATAGTGAGGTCTGAAAAGG - Intronic
1123966469 15:25464802-25464824 CTTGCTAGTAACATCTTAATAGG + Intergenic
1124604267 15:31159352-31159374 CTTGCTGATAAGCTCTGAAAAGG - Intronic
1126136004 15:45392167-45392189 GTTGTTATTAGGAACTGAAATGG + Intronic
1126980094 15:54231451-54231473 GTCATTATTAAGATCTGAAATGG - Intronic
1127619784 15:60722674-60722696 CTTGTTTGTGAGATCTGGCACGG - Intronic
1129576026 15:76747098-76747120 CTTTTTAGTAAGCTTTGAAATGG - Intronic
1131734743 15:95320156-95320178 CTTGTGATTAACATCTGAAGTGG - Intergenic
1136907592 16:34114816-34114838 TTTTTTAGTAAAATCTGCAAAGG + Intergenic
1137234891 16:46608376-46608398 TTTGGTAGAAAAATCTGAAATGG + Exonic
1138266289 16:55662158-55662180 CTTGTCAAAAGGATCTGAAAGGG + Intronic
1140724693 16:77801434-77801456 CTTCATAGTTTGATCTGAAACGG + Intronic
1148401375 17:47364651-47364673 CTTGTTAGGATGAACTGCAATGG - Intronic
1148772077 17:50073102-50073124 CTTGTTAGTAAGGCCTGTAAAGG - Intronic
1149095936 17:52840701-52840723 ATTGTTGGTATGATATGAAAGGG + Intergenic
1156672857 18:39491494-39491516 CTTGTGACTAATGTCTGAAAGGG + Intergenic
1156934863 18:42691183-42691205 CTTAGTGGTAAGATCTGGAAGGG + Intergenic
1158761400 18:60392100-60392122 CCTATTAGTAAGCTCTGGAAGGG + Intergenic
1159790128 18:72768090-72768112 CTTTTGAAAAAGATCTGAAATGG - Intronic
1161603407 19:5199757-5199779 CTTTGTAGTCAGTTCTGAAATGG + Intronic
1164284359 19:23799786-23799808 CTTGTCAGGAAGATGTGAAAAGG + Intronic
925726454 2:6877271-6877293 CTTTTTACTGTGATCTGAAAGGG + Intronic
926974344 2:18498422-18498444 CTCTTTAGGAAGATCTCAAATGG - Intergenic
931302850 2:60997841-60997863 CTCCTTAGTAAGCTCAGAAAAGG + Intronic
931315934 2:61131776-61131798 CTTTGTAGTAAGATTGGAAATGG - Intronic
932391143 2:71391635-71391657 CTGGTCAGTAAGACCTCAAAAGG + Intronic
932636564 2:73394147-73394169 CTTTATAGTAAGTTTTGAAATGG + Intronic
933190486 2:79328668-79328690 CATGTTAGGAAGATATAAAAGGG + Intronic
933336829 2:80968622-80968644 CTTATGAGTAAGATCTGTTATGG - Intergenic
934510816 2:94940692-94940714 CACGTTAGTAAGTGCTGAAATGG + Intergenic
935484336 2:103634190-103634212 CTTGTTATTAAAATCAGAAATGG - Intergenic
935510871 2:103971740-103971762 ATGGTTAGTAAAATTTGAAATGG - Intergenic
936935558 2:117835873-117835895 CTTGTTTCTAAGATCTGACTTGG - Intergenic
941833117 2:169984625-169984647 ATTTTTAGTAAGATTTAAAAAGG - Intronic
942093383 2:172515480-172515502 CTGGTCAGCAAGATCTCAAAAGG + Intergenic
942506952 2:176652943-176652965 CTAGTTAGGAAGACCTGAAAAGG + Intergenic
944375739 2:199039411-199039433 TTAGTTGGTAAGTTCTGAAAAGG - Intergenic
947304832 2:228733554-228733576 CTTGATAGTAAAATCCGAAAAGG - Intergenic
948136524 2:235640442-235640464 CTTGTTCCTAAGTTCTGAGATGG - Intronic
1168778740 20:470731-470753 CTGGTCAGTAAGACCTCAAAAGG - Intergenic
1172636373 20:36412691-36412713 CTGATCAGTAAGCTCTGAAAAGG + Intronic
1177390403 21:20461356-20461378 CTTAAAAGTAAGATCTGAAATGG + Intergenic
1178270788 21:31187912-31187934 CTTTTTAGAAATATCTGCAAAGG - Intronic
1179194178 21:39150273-39150295 CTTGTGACTGACATCTGAAATGG - Intergenic
1181386475 22:22549479-22549501 CTTGTTAGAAAACTCTGTAATGG - Intronic
1182646419 22:31813486-31813508 TTTTTTAGTAAGAGCTTAAACGG - Intronic
950381736 3:12621313-12621335 CATTTTAGTCAGAGCTGAAATGG + Intronic
953100120 3:39816389-39816411 GTTGTCAGTATGATTTGAAAAGG - Intronic
954507254 3:51088980-51089002 TCTGTTAGTCAGATCTGGAAGGG + Intronic
955614467 3:60791980-60792002 CTTGTTAGTAACTACTGATAGGG - Intronic
957758735 3:84526637-84526659 TTTATTAGTAACATCAGAAAGGG - Intergenic
957841320 3:85673620-85673642 CTTGTAAGTAAGATGTTAACAGG + Intronic
958199567 3:90293152-90293174 TTTTTTTGTAAAATCTGAAAAGG - Intergenic
958405846 3:93758687-93758709 CTCTTTTGTAAGATCTGCAAGGG - Intergenic
959741199 3:109721979-109722001 CTTGTTACTAAGTCCTTAAAAGG - Intergenic
962217315 3:133533857-133533879 CTTGTTAGTAAAAAATGAGATGG + Intergenic
962499498 3:135975401-135975423 CATGTTATTAAAATCTGGAATGG + Intronic
963295355 3:143540084-143540106 CTTGTTAGTAAGACATTTAAAGG + Intronic
963505473 3:146179623-146179645 CTTGTTTATAAGTTCTGAAAAGG - Intergenic
963710499 3:148741654-148741676 CTTGTAAGAATGATCAGAAAAGG - Exonic
966593695 3:181707965-181707987 TTTGTAATTAAAATCTGAAAAGG - Intergenic
967102443 3:186226952-186226974 CTTCTTAGTAAAATATGAAGTGG + Intronic
967865458 3:194186537-194186559 CTTGTTAGTAAGCTCTGTAAGGG - Intergenic
972559208 4:40211749-40211771 TTTGTTTGTAAGAGATGAAAAGG + Intronic
972634381 4:40870362-40870384 CTTGGTTGTAAGATATTAAATGG - Intronic
972892103 4:43570355-43570377 CTTTTCAGTAATATTTGAAAAGG + Intergenic
974518759 4:62953301-62953323 CATATGAGTAAGATTTGAAATGG + Intergenic
976619014 4:87109009-87109031 ATTGTTAGTAACATCTAACAGGG + Intronic
977072643 4:92411123-92411145 CTTGTTATTAATATCAGAATTGG + Intronic
977673369 4:99721090-99721112 GTTGTTAGAAAGATCTGAGATGG - Intergenic
978743790 4:112168582-112168604 TTTCTTAGTAAGATCTATAATGG - Intronic
979476462 4:121163965-121163987 CTTATTAATAAGAACAGAAATGG - Intronic
980096225 4:128493888-128493910 TATTTTACTAAGATCTGAAAAGG + Intergenic
980552359 4:134355739-134355761 CTTGGTCGTAAGTTCTAAAACGG + Intergenic
981675733 4:147340777-147340799 CTCATTAGTGAGATCTCAAATGG - Intergenic
982841969 4:160200000-160200022 GTTCTTAGTAACATCTAAAATGG + Intergenic
984414341 4:179437332-179437354 CTTGTTTGAAGGATCTGAAATGG - Intergenic
984551457 4:181164761-181164783 CTTTTTTGGAAGATATGAAATGG + Intergenic
986397052 5:7341512-7341534 ATTGTTAGTGATATCTGAGAGGG - Intergenic
986570681 5:9161571-9161593 GTGGTTAGTATGAACTGAAATGG - Intronic
990103574 5:52225911-52225933 CTTTATAGTACTATCTGAAAAGG + Intergenic
990477582 5:56175943-56175965 ATTGTTAGGAAGATCCAAAATGG + Intronic
993913380 5:93711244-93711266 CTTGTCATTGAGATGTGAAATGG - Intronic
997279678 5:132632066-132632088 CTTGGTAGTAGGAATTGAAATGG - Intronic
998255716 5:140585898-140585920 CTTCGTAGTAAGCTTTGAAATGG - Intronic
998424761 5:142017117-142017139 CTTGTTATTAAGATGTGATCTGG + Intergenic
1000651872 5:163828536-163828558 ATTGTTAGTAAGAACTGTACTGG + Intergenic
1000984226 5:167849608-167849630 CTTGTGATTAACATCTGAAGTGG - Intronic
1003941286 6:11029831-11029853 CTTGTAAGTCAGTTGTGAAAGGG - Intronic
1004384522 6:15161098-15161120 CTTCTTGGGAAGATCAGAAAGGG + Intergenic
1006975791 6:38099601-38099623 ATTTTTAGTAAGTTTTGAAAGGG - Intronic
1007020408 6:38514534-38514556 CATGTTTGTAAGACATGAAAGGG - Intronic
1007135585 6:39518684-39518706 ACTGTTAATAAGACCTGAAAGGG + Intronic
1008144189 6:47870652-47870674 CTTCTTTGTGAGATCTAAAATGG + Intergenic
1008410293 6:51170718-51170740 TTTGTGAATAAGACCTGAAAAGG - Intergenic
1008943448 6:57071834-57071856 CCAGTCAGTAAGACCTGAAAAGG + Intergenic
1009058537 6:58369019-58369041 CTTGTAAGTCAGATCTGATAGGG - Intergenic
1009254160 6:61354833-61354855 CTTTTTTGTAAAATCTGCAAAGG + Intergenic
1009258846 6:61456654-61456676 CTTTTTTGTAAAATCTGCAAAGG + Intergenic
1009572761 6:65409543-65409565 CATGTTAGAAAAAACTGAAAAGG + Intronic
1009712649 6:67345638-67345660 ATTGTTAGTGAAATCTGAACAGG - Intergenic
1010625959 6:78136448-78136470 CTGGTCAGTAAGACCTCAAAAGG + Intergenic
1010838627 6:80620509-80620531 GATGTTATTAAGATCTAAAAAGG - Intergenic
1011007749 6:82666627-82666649 CTTATTATTATGCTCTGAAAAGG - Intergenic
1013944702 6:115707601-115707623 CTTGCTAGTGAAGTCTGAAATGG + Intergenic
1013968828 6:115990319-115990341 TTTATTATTAAGATCTCAAAAGG - Intronic
1015274110 6:131366883-131366905 GTTGTTAGCAATTTCTGAAAGGG - Intergenic
1016057914 6:139598045-139598067 CTTCTTAGTAATGTTTGAAAAGG - Intergenic
1017360178 6:153559539-153559561 CTTGCATGTAAGAACTGAAATGG + Intergenic
1018162790 6:161063717-161063739 GTTGGCAGTAAGGTCTGAAAGGG - Intronic
1018999753 6:168739977-168739999 CTCATTAGTAAGAACTAAAAAGG - Intergenic
1020015308 7:4827865-4827887 CTTGTTACTAAAATCAGACAAGG + Intronic
1020336759 7:7068135-7068157 ATTGTTTGTAATATCTAAAAGGG + Intergenic
1020827761 7:13052674-13052696 CTTGCTAATTAGATATGAAATGG + Intergenic
1022029229 7:26476991-26477013 GCTGTTAGTCAGATTTGAAAAGG - Intergenic
1023209607 7:37789465-37789487 ATTATAAGTAATATCTGAAAGGG - Intronic
1023488220 7:40709683-40709705 CTGGTCAGGAAGATCTGAATGGG + Intronic
1023882623 7:44329039-44329061 CTTGTTATCAAGCTCTGCAAAGG - Intronic
1024329500 7:48141991-48142013 CTGGTCAGTAAGACCTCAAAAGG + Intergenic
1026423802 7:70269376-70269398 CTTGGAAGGAAGGTCTGAAAAGG - Intronic
1028222554 7:88214438-88214460 TTTGTGAGAAGGATCTGAAAGGG + Intronic
1031727211 7:125255241-125255263 CTTGATTGTAAAATCTGACAAGG + Intergenic
1034652146 7:152700091-152700113 TTTGTTGGTAAGATCTGCTATGG + Intergenic
1039780592 8:40781377-40781399 CTTTTTAGTAAGTTTTGAACTGG - Intronic
1040761262 8:50848085-50848107 CATGTAAGAAAGATCAGAAAAGG - Intergenic
1040892695 8:52334307-52334329 CTTGATAGTATGGTTTGAAATGG + Intronic
1042245418 8:66705195-66705217 CTTGTTTCTATGATTTGAAAAGG - Intronic
1043266483 8:78272878-78272900 TTTGATAGTGACATCTGAAAAGG - Intergenic
1043773757 8:84238604-84238626 CTGGTGAGTAAGATCAGAGAGGG + Intronic
1044137978 8:88610949-88610971 CTGGTCAGTAAGACCTCAAAAGG - Intergenic
1045105567 8:98889166-98889188 CTTTTTAATTAGGTCTGAAAAGG - Intronic
1046384139 8:113486811-113486833 CTGGGTATTAGGATCTGAAATGG + Intergenic
1046766826 8:118078505-118078527 CTTGTTAGTAAAATTTAAAAAGG - Intronic
1051807647 9:21013412-21013434 CTTTGTAGTAAGTTTTGAAATGG + Intronic
1052216620 9:25973504-25973526 CATTTTAGCAAGATCTTAAAGGG + Intergenic
1053189266 9:36047942-36047964 TTGGTTGGTAAGATCTGAAGAGG + Intronic
1053654570 9:40203660-40203682 CACGTTAGTAAGTGCTGAAATGG - Intergenic
1053904961 9:42832867-42832889 CACGTTAGTAAGTGCTGAAATGG - Intergenic
1054362257 9:64185546-64185568 CTTTTTTGTAAAATCTGCAAAGG + Intergenic
1054366685 9:64349877-64349899 CACGTTAGTAAGTGCTGAAATGG - Intergenic
1054530025 9:66172650-66172672 CACGTTAGTAAGTGCTGAAATGG + Intergenic
1054674314 9:67839619-67839641 CACGTTAGTAAGTGCTGAAATGG - Intergenic
1055356759 9:75445583-75445605 CTGGATAGTAAGATTTGTAAAGG + Intergenic
1055939492 9:81636162-81636184 ATTGTTATTATGATCTCAAATGG - Intronic
1055988402 9:82078245-82078267 CTTGGTAGTAAGCTTTTAAAAGG + Intergenic
1056024000 9:82473176-82473198 CTTTGTAGTAAGTTTTGAAAAGG - Intergenic
1056542234 9:87582155-87582177 GTAGCTAGTGAGATCTGAAATGG + Intronic
1057127298 9:92628409-92628431 CTTTTTAGTAGGTTTTGAAATGG - Intronic
1058684748 9:107470265-107470287 CTTGCTTCTGAGATCTGAAATGG + Intergenic
1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG + Exonic
1059692723 9:116701044-116701066 CTTGTTTTTAAGATCAGAAGTGG + Exonic
1203382532 Un_KI270435v1:70714-70736 TTTTTTTGTAAGATCTGCAAAGG + Intergenic
1187751003 X:22464934-22464956 CGTGTTTCTAAGTTCTGAAATGG + Intergenic
1188573135 X:31613622-31613644 CTTATGAGTAAGATCAGAGAAGG - Intronic
1191583169 X:62788245-62788267 CTTTTTTGTAAGATCTGCAAAGG - Intergenic
1192163349 X:68805496-68805518 CTTTCTAGTAAGTTTTGAAAGGG - Intergenic
1194486552 X:94493527-94493549 CTGGTCAGTAAGACCTCAAAAGG + Intergenic
1196567479 X:117226376-117226398 CTTGTCAGTAAAATGTGAAAAGG + Intergenic
1196822947 X:119717777-119717799 CTTTGTAGTAAGTTTTGAAATGG - Intergenic
1198566388 X:137909670-137909692 TTTGATGGGAAGATCTGAAATGG - Intergenic
1199597118 X:149514919-149514941 CTTGCTAGTAAAACCTAAAATGG - Intronic
1201054686 Y:9976832-9976854 CTGGTCAGTAAGACCTCAAAAGG + Intergenic