ID: 1059140708

View in Genome Browser
Species Human (GRCh38)
Location 9:111850573-111850595
Sequence GATGCAGCAATTCTTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059140707_1059140708 -7 Left 1059140707 9:111850557-111850579 CCTACAAATGCTGTATGATGCAG No data
Right 1059140708 9:111850573-111850595 GATGCAGCAATTCTTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059140708 Original CRISPR GATGCAGCAATTCTTCTTTA AGG Intergenic
No off target data available for this crispr