ID: 1059141572

View in Genome Browser
Species Human (GRCh38)
Location 9:111857871-111857893
Sequence TTACCTTGAAGGTCTACTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059141572_1059141576 -3 Left 1059141572 9:111857871-111857893 CCGTCAGTAGACCTTCAAGGTAA No data
Right 1059141576 9:111857891-111857913 TAAGGGACACTCTTCCAAAATGG No data
1059141572_1059141577 10 Left 1059141572 9:111857871-111857893 CCGTCAGTAGACCTTCAAGGTAA No data
Right 1059141577 9:111857904-111857926 TCCAAAATGGAAACACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059141572 Original CRISPR TTACCTTGAAGGTCTACTGA CGG (reversed) Intergenic
No off target data available for this crispr