ID: 1059145548

View in Genome Browser
Species Human (GRCh38)
Location 9:111896680-111896702
Sequence CCGCGCGCCCGCTGCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 289}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059145548_1059145557 3 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145557 9:111896706-111896728 ACAGGGTGGGCGTGGACCGATGG 0: 1
1: 0
2: 0
3: 3
4: 128
1059145548_1059145555 -10 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145555 9:111896693-111896715 GGGCGCGCGGGCGACAGGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 206
1059145548_1059145564 24 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145564 9:111896727-111896749 GGGGGCACCGCCCCTGGGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 320
1059145548_1059145559 5 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145559 9:111896708-111896730 AGGGTGGGCGTGGACCGATGGGG 0: 1
1: 0
2: 0
3: 11
4: 128
1059145548_1059145566 28 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145566 9:111896731-111896753 GCACCGCCCCTGGGAGAGGCGGG 0: 1
1: 1
2: 2
3: 36
4: 380
1059145548_1059145563 19 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145563 9:111896722-111896744 CCGATGGGGGCACCGCCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1059145548_1059145565 27 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145565 9:111896730-111896752 GGCACCGCCCCTGGGAGAGGCGG 0: 1
1: 0
2: 4
3: 41
4: 287
1059145548_1059145560 6 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145560 9:111896709-111896731 GGGTGGGCGTGGACCGATGGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1059145548_1059145558 4 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145558 9:111896707-111896729 CAGGGTGGGCGTGGACCGATGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1059145548_1059145561 18 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145561 9:111896721-111896743 ACCGATGGGGGCACCGCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1059145548_1059145556 -5 Left 1059145548 9:111896680-111896702 CCGGCGCCGCAGCGGGCGCGCGG 0: 1
1: 0
2: 0
3: 29
4: 289
Right 1059145556 9:111896698-111896720 CGCGGGCGACAGGGTGGGCGTGG 0: 1
1: 0
2: 4
3: 15
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059145548 Original CRISPR CCGCGCGCCCGCTGCGGCGC CGG (reversed) Intergenic