ID: 1059149073

View in Genome Browser
Species Human (GRCh38)
Location 9:111931296-111931318
Sequence CAAGTTGCAATGCAAAACTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059149073 Original CRISPR CAAGTTGCAATGCAAAACTC TGG Exonic
904382407 1:30120205-30120227 GAATTTGCAATGGAAATCTCAGG - Intergenic
904815028 1:33189458-33189480 CAACTTACAATGGGAAACTCTGG + Intergenic
905245623 1:36611218-36611240 CAAATTGAAAGGCAAAACCCTGG - Intergenic
905495563 1:38382882-38382904 GTAGTTGCAATGGAAAAATCAGG + Intergenic
909832484 1:80210173-80210195 TAATTTTCAATGTAAAACTCTGG + Intergenic
918582397 1:186146365-186146387 CTAGATGCAATGCATGACTCAGG - Intronic
922070230 1:222184926-222184948 CCAGGTGCACTGCTAAACTCTGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1065995120 10:31052283-31052305 CAACTTGCAAAGCAAAAATAAGG + Intergenic
1068325459 10:55480177-55480199 CAAGTAGAACTGCAAATCTCTGG - Intronic
1068347888 10:55807662-55807684 CAATTTGCAATGCAAAAACGTGG - Intergenic
1069089252 10:64179615-64179637 CAAGTAGCAATGCAAGAGCCAGG - Intergenic
1070268505 10:74928057-74928079 CAGTCTACAATGCAAAACTCAGG + Intronic
1071423220 10:85522887-85522909 GAAGTTGAAATCCAAAAATCTGG - Intergenic
1071805373 10:89114217-89114239 CAAGTTGGAATGTAAAACTTCGG + Intergenic
1073824863 10:107308988-107309010 CAACTGGCAATGGAAAACTAGGG - Intergenic
1075843542 10:125525735-125525757 TAAGTTAAAATGCAAAACCCAGG - Intergenic
1082216663 11:49578914-49578936 GAAATTGCAATGCCAAATTCAGG + Intergenic
1082989373 11:59194123-59194145 CGAGTTGCAATGCAAAGCTGGGG + Intronic
1086632894 11:89045173-89045195 GAAATTGCAATGCCAAATTCAGG - Intronic
1090849143 11:130556361-130556383 CAAGTTGGGATGCAAAAATAAGG + Intergenic
1091258228 11:134210526-134210548 AAAGTTACAAAGCAAAACACAGG + Intronic
1099366563 12:81772412-81772434 GAAGTAGGAATGCAAAACTTGGG + Intergenic
1100663235 12:96723319-96723341 AAAGTTGGAGTACAAAACTCAGG - Intronic
1102989826 12:117307037-117307059 CAACTTGCAAAGCATAACTTTGG - Intronic
1105301126 13:19135607-19135629 CAACTTGCAATGTAAGTCTCTGG + Intergenic
1108940721 13:55949200-55949222 CAAGTTGGAAAACACAACTCTGG + Intergenic
1108964766 13:56284321-56284343 CAATTTTCAATGCAAAATTTAGG + Intergenic
1110003053 13:70230180-70230202 CAAGGTATAATCCAAAACTCAGG - Intergenic
1110469970 13:75848524-75848546 CAATTCGCAATGCAAAAATGTGG - Intronic
1110469985 13:75848680-75848702 CAATTTGCAAGGCAAAAATGTGG - Intronic
1113615830 13:111680184-111680206 CAAGTTGCAACGACAAACGCGGG - Intergenic
1113621298 13:111765077-111765099 CAAGTTGCAACGACAAACGCGGG - Intergenic
1122080974 14:99267751-99267773 CAAGATTCAATGCAAAAGTTAGG - Intronic
1122560552 14:102611033-102611055 CAAGTTGAAATGGAAAGCTTAGG + Intronic
1124910722 15:33917282-33917304 CAATTTGCAATACAAAAATATGG + Intronic
1126788441 15:52198493-52198515 AAAGTAGCAATGCAAAAATGAGG - Intronic
1128620052 15:69141334-69141356 GAAGTCACAATGCAAAACCCTGG + Intergenic
1135114534 16:19713745-19713767 CCACTTGCTATCCAAAACTCAGG - Intronic
1135787380 16:25362219-25362241 AAAGTGGCAATGCAAAACACTGG - Intergenic
1139292905 16:65874248-65874270 TAAGGTGCAATGCAAGGCTCTGG + Intergenic
1142831988 17:2555996-2556018 TTAGTTGTAATGGAAAACTCTGG + Intergenic
1144047026 17:11463133-11463155 CAGGCTGCAAAGGAAAACTCGGG + Intronic
1144183519 17:12774609-12774631 TAAGTTGCATTGCAAAAAGCTGG + Intergenic
1146648389 17:34590688-34590710 CAAGATACAATGCTAAATTCAGG + Intronic
1147023433 17:37558846-37558868 CAAGTAGCAGTTCAAAGCTCGGG - Intronic
1151777154 17:76213131-76213153 CAAGTTTAAAGGCAAAAGTCAGG - Intronic
1156081172 18:33338467-33338489 AAACTTGCAATGCAAAAATATGG + Intronic
1157178224 18:45471231-45471253 CATGTTGCTATGGAAAACTCTGG + Intronic
1157798493 18:50598709-50598731 CTAAGTGCAATGCTAAACTCTGG - Intronic
1158869700 18:61673647-61673669 CAGTTTGCTCTGCAAAACTCAGG + Intergenic
1159543555 18:69812413-69812435 CAAATTGCCATGCAAAACTGAGG + Intronic
1159688605 18:71457089-71457111 CAAGTTTTAATGCAAAGTTCAGG - Intergenic
1164224676 19:23232354-23232376 CAAGTTGAAATGAAAGACTAAGG + Intronic
1164933079 19:32190257-32190279 GAAGATGCAATGCAAAAATGTGG + Intergenic
925834011 2:7925367-7925389 CTACTTGCTATTCAAAACTCAGG + Intergenic
926254877 2:11183945-11183967 CAAGTTGCAAAACATAAATCAGG - Intronic
931121088 2:59220687-59220709 CAAATTACAATGCAAAATACTGG + Intergenic
931702148 2:64917996-64918018 CCAGTTGGAATGCAAAAGTAAGG + Intergenic
935183034 2:100706980-100707002 CAAGTTGCAATAGAAAACCCAGG - Intergenic
936581832 2:113706947-113706969 CAAGTTGCAAGACAAAACCAGGG + Intronic
939140586 2:138349774-138349796 CAAGGTGCAATGAAGAACTCAGG - Intergenic
939954828 2:148519109-148519131 GAAGCTGCAGTGGAAAACTCAGG + Intergenic
942201552 2:173576573-173576595 CAAGTTTTCAAGCAAAACTCGGG - Intergenic
943943946 2:194034581-194034603 CAATTTGCACTGCAAAAATATGG + Intergenic
948442181 2:238000749-238000771 CTAGTAGGAATGCAAAACTTTGG - Intronic
948630188 2:239297410-239297432 TAAATGGCAATGCAAAGCTCTGG - Intronic
1169879445 20:10330531-10330553 CAAGTTTAAAAGCAAAACTTTGG + Intergenic
1172824159 20:37766204-37766226 CAAATGGCAATGCCAAATTCTGG - Intronic
1182889619 22:33806354-33806376 CAAGCTGCAGTCCAAAAGTCTGG + Intronic
1184540755 22:45122625-45122647 CAAGTTCCAATCAAAAAGTCTGG + Intergenic
951964206 3:28364383-28364405 CAATTTGCAATGTAAAAATATGG - Intronic
964450971 3:156812893-156812915 CCAGTTGCAATGCAAGACTGAGG + Intergenic
965812375 3:172604600-172604622 CAAGTTGAAATGCTTAACACAGG - Intergenic
966272848 3:178129515-178129537 CAAGTCTCAATGCAAAGGTCAGG - Intergenic
969464230 4:7345141-7345163 CAATTTTCAAAGCAAAACTTTGG + Intronic
970914300 4:21314727-21314749 AAAATGCCAATGCAAAACTCTGG + Intronic
971213867 4:24645729-24645751 AAAGTTGGAATAAAAAACTCAGG + Intergenic
971893098 4:32551421-32551443 GAAGTTGAAAGGGAAAACTCAGG - Intergenic
973284661 4:48402360-48402382 CAAGTTGGAATGCATACTTCAGG - Intronic
974523486 4:63017098-63017120 AAGCTTGAAATGCAAAACTCTGG - Intergenic
977206934 4:94173656-94173678 TAAGTTCCAATACAAAACTCTGG - Intergenic
978366546 4:107989312-107989334 TGAGTTACAATGCAAAAATCAGG - Intergenic
979135453 4:117105984-117106006 TAAGTTGCAAGGCAGAGCTCCGG - Intergenic
982161550 4:152575292-152575314 CAAGTTACCATGCATAACCCGGG - Intergenic
986855401 5:11863034-11863056 CAGGTTGCATTGCTAAACTAGGG - Intronic
986917813 5:12644679-12644701 CAATTTGCATTGCAAAAATATGG + Intergenic
988856314 5:35230896-35230918 CAAGGTGCAATTCAAATCCCTGG - Intergenic
989690320 5:44135760-44135782 CAATTTGCAATGTAAAAATATGG - Intergenic
990196872 5:53327419-53327441 CATGTTTCAATGCCAAACTCTGG + Intergenic
992562101 5:77963067-77963089 GAAGCTGCAATGGACAACTCTGG - Intergenic
994318996 5:98367824-98367846 CAAGTTTCAATGCAGAAGTCTGG + Intergenic
996511904 5:124325933-124325955 CTAGATGCAATGCATAATTCTGG + Intergenic
1001060915 5:168487722-168487744 CAACTTAAACTGCAAAACTCAGG - Intronic
1002110248 5:176904291-176904313 GAAGTTGTAATGAAAAACTGGGG - Intergenic
1003719525 6:8685387-8685409 CAAATTGTAATGGAAAACTAGGG + Intergenic
1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG + Intergenic
1005127747 6:22467786-22467808 CTAGTTGCAATGAAATACCCTGG + Intergenic
1009337395 6:62508731-62508753 TAAGTTGCAAGTCAAAAATCAGG + Intergenic
1012298923 6:97559957-97559979 CAACTTGCAATTCAAAAATATGG - Intergenic
1013683302 6:112549035-112549057 TAAATTGCAAAGCAAGACTCTGG - Intergenic
1015808900 6:137141708-137141730 CAAGATGCAATACAGAAATCTGG - Intergenic
1018010235 6:159663126-159663148 CAATTTGCATTGCAAAATTGTGG + Intergenic
1018134981 6:160770570-160770592 CAGGTTCCAATGCAAATATCTGG - Intergenic
1018218614 6:161555765-161555787 CAAGATACTATGCCAAACTCAGG - Intronic
1021695787 7:23274980-23275002 CAAGTTGCCATGAAAAACCAGGG - Exonic
1024194563 7:47046346-47046368 AAAGTTGCAATGAAAAAAACAGG + Intergenic
1024376458 7:48644262-48644284 CAAGTCCCAGTGTAAAACTCAGG + Intronic
1028447242 7:90939819-90939841 CAAGTTGCCTTCCAAAGCTCAGG - Intronic
1030127927 7:106172131-106172153 GAAGTGGGAAGGCAAAACTCAGG - Intergenic
1031205922 7:118757490-118757512 CCAGTTGAAAGCCAAAACTCTGG + Intergenic
1041006107 8:53498226-53498248 CAAGTTGGAATGCTATCCTCTGG + Intergenic
1041504303 8:58577723-58577745 CAACTTGGAATACAAAACTAAGG - Intronic
1041952292 8:63517174-63517196 CAAGATTCCTTGCAAAACTCTGG - Intergenic
1044070962 8:87759474-87759496 AAAGTTGCAATCAAAGACTCAGG + Intergenic
1045498337 8:102726915-102726937 CAAGTTGCATTTGAAAACACAGG + Intergenic
1046420522 8:113977170-113977192 CATGTTGCAAAACAAAACTAAGG - Intergenic
1047595123 8:126370551-126370573 CAGGCTGCAATGCAGAACCCTGG + Intergenic
1048616843 8:136084288-136084310 CAAGATGAAATGCAAAATTGTGG + Intergenic
1055258423 9:74401800-74401822 TAAGCTGAATTGCAAAACTCAGG - Intergenic
1058441770 9:105015445-105015467 CCAGTTGCAATCCAACACTTTGG + Intergenic
1059149073 9:111931296-111931318 CAAGTTGCAATGCAAAACTCTGG + Exonic
1060612814 9:124983804-124983826 CAAGTTGGAATGTAAAACAATGG - Intronic
1062239803 9:135530762-135530784 CAAGTAGCAATGATTAACTCTGG - Intergenic
1062633818 9:137479348-137479370 CAAGTTGCTTTGCAGAACCCAGG - Intronic
1062676103 9:137745013-137745035 CAAGTTGACATGCAAATCTGTGG + Intronic
1189335058 X:40166137-40166159 CAAGCTACGATGGAAAACTCTGG - Intronic
1189617873 X:42802738-42802760 AAAATTGCAATTCATAACTCAGG - Intergenic
1191652786 X:63559567-63559589 CAACTAGCAATGAAAATCTCTGG - Intergenic
1196092367 X:111759338-111759360 CATTTAGCAATGAAAAACTCAGG - Intronic