ID: 1059153159

View in Genome Browser
Species Human (GRCh38)
Location 9:111967130-111967152
Sequence TCTTCTCTGCAGGATCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059153159_1059153162 -6 Left 1059153159 9:111967130-111967152 CCCAGCAGATCCTGCAGAGAAGA No data
Right 1059153162 9:111967147-111967169 AGAAGACATCATCTCTTTCCTGG No data
1059153159_1059153164 15 Left 1059153159 9:111967130-111967152 CCCAGCAGATCCTGCAGAGAAGA No data
Right 1059153164 9:111967168-111967190 GGTGACAGTGCCTATCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059153159 Original CRISPR TCTTCTCTGCAGGATCTGCT GGG (reversed) Intergenic
No off target data available for this crispr