ID: 1059156445

View in Genome Browser
Species Human (GRCh38)
Location 9:111993024-111993046
Sequence CAATAGTATTTTAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059156445_1059156448 15 Left 1059156445 9:111993024-111993046 CCCACCAAATTAAAATACTATTG No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059156445 Original CRISPR CAATAGTATTTTAATTTGGT GGG (reversed) Intergenic
No off target data available for this crispr