ID: 1059156448

View in Genome Browser
Species Human (GRCh38)
Location 9:111993062-111993084
Sequence ATACAACTTATAAATATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059156445_1059156448 15 Left 1059156445 9:111993024-111993046 CCCACCAAATTAAAATACTATTG No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156446_1059156448 14 Left 1059156446 9:111993025-111993047 CCACCAAATTAAAATACTATTGC No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156442_1059156448 18 Left 1059156442 9:111993021-111993043 CCCCCCACCAAATTAAAATACTA No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156443_1059156448 17 Left 1059156443 9:111993022-111993044 CCCCCACCAAATTAAAATACTAT No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156441_1059156448 21 Left 1059156441 9:111993018-111993040 CCTCCCCCCACCAAATTAAAATA No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156444_1059156448 16 Left 1059156444 9:111993023-111993045 CCCCACCAAATTAAAATACTATT No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data
1059156447_1059156448 11 Left 1059156447 9:111993028-111993050 CCAAATTAAAATACTATTGCAAA No data
Right 1059156448 9:111993062-111993084 ATACAACTTATAAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059156448 Original CRISPR ATACAACTTATAAATATTAA TGG Intergenic
No off target data available for this crispr