ID: 1059158705

View in Genome Browser
Species Human (GRCh38)
Location 9:112013299-112013321
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059158705_1059158710 -8 Left 1059158705 9:112013299-112013321 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1059158710 9:112013314-112013336 TTCCAAAGCACTAGGATTACAGG 0: 28
1: 430
2: 5444
3: 51404
4: 350613
1059158705_1059158712 11 Left 1059158705 9:112013299-112013321 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1059158712 9:112013333-112013355 CAGGTATGAGCCACCATACCCGG 0: 38
1: 2021
2: 31152
3: 105350
4: 195768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059158705 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr