ID: 1059176643

View in Genome Browser
Species Human (GRCh38)
Location 9:112174899-112174921
Sequence GTCCCCCGGCGTCGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059176624_1059176643 28 Left 1059176624 9:112174848-112174870 CCTGGGCAGTGGAGGTCCCTGGG 0: 1
1: 0
2: 4
3: 49
4: 613
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176636_1059176643 -7 Left 1059176636 9:112174883-112174905 CCGCCTTAAAACCGGCGTCCCCC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176633_1059176643 2 Left 1059176633 9:112174874-112174896 CCGGCCAGGCCGCCTTAAAACCG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176631_1059176643 11 Left 1059176631 9:112174865-112174887 CCTGGGGGCCCGGCCAGGCCGCC 0: 1
1: 0
2: 4
3: 49
4: 517
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176632_1059176643 3 Left 1059176632 9:112174873-112174895 CCCGGCCAGGCCGCCTTAAAACC 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176638_1059176643 -10 Left 1059176638 9:112174886-112174908 CCTTAAAACCGGCGTCCCCCGGC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176635_1059176643 -2 Left 1059176635 9:112174878-112174900 CCAGGCCGCCTTAAAACCGGCGT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data
1059176630_1059176643 12 Left 1059176630 9:112174864-112174886 CCCTGGGGGCCCGGCCAGGCCGC 0: 1
1: 0
2: 3
3: 25
4: 351
Right 1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059176643 Original CRISPR GTCCCCCGGCGTCGCGGGGT CGG Intronic
No off target data available for this crispr