ID: 1059176731

View in Genome Browser
Species Human (GRCh38)
Location 9:112175142-112175164
Sequence CCGCGGCGCCGCGGGAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059176731_1059176739 3 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176739 9:112175168-112175190 AGGCCGAGCAGCAGCAACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 288
1059176731_1059176743 21 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176743 9:112175186-112175208 AGCGGCAGCAGGCGGCGAGACGG 0: 1
1: 0
2: 3
3: 19
4: 199
1059176731_1059176741 10 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176741 9:112175175-112175197 GCAGCAGCAACAGCGGCAGCAGG 0: 1
1: 2
2: 114
3: 288
4: 1062
1059176731_1059176744 22 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176744 9:112175187-112175209 GCGGCAGCAGGCGGCGAGACGGG 0: 1
1: 0
2: 0
3: 22
4: 187
1059176731_1059176742 13 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176742 9:112175178-112175200 GCAGCAACAGCGGCAGCAGGCGG 0: 1
1: 1
2: 35
3: 236
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059176731 Original CRISPR CCGCGGCGCCGCGGGAGCGC CGG (reversed) Exonic