ID: 1059176731

View in Genome Browser
Species Human (GRCh38)
Location 9:112175142-112175164
Sequence CCGCGGCGCCGCGGGAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059176731_1059176743 21 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176743 9:112175186-112175208 AGCGGCAGCAGGCGGCGAGACGG 0: 1
1: 0
2: 3
3: 19
4: 199
1059176731_1059176741 10 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176741 9:112175175-112175197 GCAGCAGCAACAGCGGCAGCAGG 0: 1
1: 2
2: 114
3: 288
4: 1062
1059176731_1059176739 3 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176739 9:112175168-112175190 AGGCCGAGCAGCAGCAACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 288
1059176731_1059176744 22 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176744 9:112175187-112175209 GCGGCAGCAGGCGGCGAGACGGG 0: 1
1: 0
2: 0
3: 22
4: 187
1059176731_1059176742 13 Left 1059176731 9:112175142-112175164 CCGGCGCTCCCGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 27
4: 322
Right 1059176742 9:112175178-112175200 GCAGCAACAGCGGCAGCAGGCGG 0: 1
1: 1
2: 35
3: 236
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059176731 Original CRISPR CCGCGGCGCCGCGGGAGCGC CGG (reversed) Exonic
900082656 1:870036-870058 CCGCGGCCCCGCTGGAGGGCAGG - Intergenic
900314606 1:2050584-2050606 GCGCTGCGCCCCGGGAGCTCCGG - Exonic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
902089643 1:13893097-13893119 GCGCGGGGACGCGGGAGCCCAGG + Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904045006 1:27603599-27603621 GGGGGGCGCCGCGGGAGCGGGGG - Exonic
904181413 1:28669023-28669045 TCGCGGCGCCGCGGGGGGGTGGG + Intronic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
904724853 1:32539585-32539607 ACGCGGCGCCGGCGGAGGGCGGG + Intronic
906032418 1:42732315-42732337 GCGGGGGGCGGCGGGAGCGCTGG - Intergenic
906517478 1:46448210-46448232 GCGCGCGGCCTCGGGAGCGCTGG + Intergenic
907038364 1:51236452-51236474 CCGCCGCCCCGCGGGGGGGCGGG + Exonic
907051195 1:51330678-51330700 CCCCGGCGGTGCGGGAGCGCGGG - Intronic
907357642 1:53889637-53889659 CCGCGGCGGCCCGGGCGGGCAGG + Intronic
907486419 1:54781258-54781280 CCAGCGCGCCGCGGGACCGCCGG - Exonic
908780520 1:67685871-67685893 TGACGGGGCCGCGGGAGCGCCGG + Intronic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
910237215 1:85048322-85048344 CCGCGGCGCACAGGGAGGGCCGG - Intronic
912270047 1:108199922-108199944 CCGGGGCGCCGCCTGAGCGTAGG - Intronic
912381283 1:109249557-109249579 CCGGGGAGGCGAGGGAGCGCGGG + Intergenic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
912793547 1:112675415-112675437 CCCAGGCATCGCGGGAGCGCGGG + Intronic
912798582 1:112707144-112707166 CCGCGGCGCTGGAGGAGGGCGGG - Intronic
914702745 1:150149707-150149729 CCGAGCCGCCGCCGGAGCGAGGG + Intronic
914702929 1:150150339-150150361 CCGCGGCGCCGACGGAGCGGGGG - Intronic
915519859 1:156435804-156435826 CCGCAGAGCCGCGGGTGCGCGGG + Intergenic
916052387 1:161045545-161045567 CCGCGGAGCAGCTGGGGCGCGGG - Intronic
916497240 1:165356724-165356746 CCGCGGCGCTGCGTGCGCGGCGG + Intergenic
917817625 1:178725919-178725941 CCGCGACTCCGCGGGTTCGCGGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919075511 1:192808663-192808685 CGGCGGCCCGGCGGGGGCGCCGG - Intergenic
920171238 1:204073580-204073602 CCGCGACGCGGCGGGCGGGCCGG - Intronic
922730700 1:227947673-227947695 CCGGGGCGCGGCGGGGCCGCCGG - Intronic
924052369 1:240092067-240092089 CCGCCGCGCCGCGGGCACTCAGG - Exonic
1063593010 10:7410386-7410408 CGGAGGAGACGCGGGAGCGCGGG + Intronic
1064478794 10:15719690-15719712 CTGCTGCGCCGCGGCCGCGCTGG - Exonic
1065024310 10:21526347-21526369 CCGCGACGCCGCGGAAGGGCTGG - Intergenic
1065099867 10:22321790-22321812 CGGCGGCGCGGCCGGGGCGCGGG - Intronic
1065188702 10:23192334-23192356 CCCCAGCGCAGCGCGAGCGCGGG + Exonic
1066023081 10:31320829-31320851 CCCGGGGGCGGCGGGAGCGCAGG + Intronic
1066994750 10:42553207-42553229 CCGCGGCGCAGCGGGGCCACAGG - Intergenic
1067830972 10:49610805-49610827 GCGCGGCGCTGCAGGAGCCCCGG + Exonic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1072169814 10:92848483-92848505 GCGCGGCGCCGCGGGAACGACGG - Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072970083 10:100009852-100009874 CTGCCGCGCCGAGGGACCGCCGG - Exonic
1073325900 10:102643944-102643966 CCGGGGCGCTGCGTGCGCGCAGG - Intergenic
1075430299 10:122374772-122374794 CCGCGGCGGCGCGGGTGCTCCGG + Exonic
1075521485 10:123146255-123146277 CCTCTGCGCCGCGGCGGCGCAGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1078371626 11:10751276-10751298 CCGCGGCGCCGCTGGAGCTCTGG - Exonic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1081699957 11:45146748-45146770 CGGCCGCGCTGCGGGCGCGCTGG - Intronic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083579060 11:63813473-63813495 CCTCGGCGCGTCGGGAGCCCGGG - Exonic
1083644923 11:64166416-64166438 CCGCGGCGGAGCAGGCGCGCCGG + Intergenic
1083743517 11:64723104-64723126 CCGCGGCGGGGCGGGCGGGCGGG - Exonic
1084385442 11:68840878-68840900 CGGCGGGGCCGCGGGAGGGTGGG - Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1089347063 11:117797289-117797311 CCGGGGTGCCGCGGGGGGGCGGG - Intronic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1090238636 11:125166566-125166588 GCGCGGCGGGGCGGGAGCGGTGG + Intronic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1091461005 12:643266-643288 CAGCCGCGCCGCCGGAGGGCAGG - Intronic
1091869218 12:3873308-3873330 CCGCGGGTCCCCGGGAGCGAAGG + Exonic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1098819086 12:75207485-75207507 CCGCGACGCCGAGGAGGCGCTGG - Exonic
1100869551 12:98895356-98895378 GCGCGGCTCCGCGGGTGCCCAGG + Intronic
1102437763 12:112938640-112938662 CCGCTGCCCTGAGGGAGCGCGGG + Exonic
1102884073 12:116508526-116508548 CGGCGGCGCGGCGGGCCCGCTGG - Intergenic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1104891711 12:132143471-132143493 GCGCGGCGCGGCGGGAGGACAGG + Intronic
1105049685 12:133037499-133037521 TCGCGAGGCCGCGGGCGCGCGGG + Intronic
1105512202 13:21060839-21060861 CCGCTGCGCCGCCGGACCGGGGG + Intronic
1107605264 13:42049312-42049334 CCGCGGCTCGGCGGGAGCGTGGG + Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1113820279 13:113208731-113208753 CGGCCCCGCCGCGGGTGCGCAGG + Intronic
1114031455 14:18583978-18584000 CCGCAGCCCCGCTGGAGGGCAGG - Intergenic
1114519084 14:23321700-23321722 CCGCGCCCCCCCGGGAGCTCCGG + Exonic
1115761729 14:36582883-36582905 GCCAGGCCCCGCGGGAGCGCCGG + Intergenic
1117392059 14:55271634-55271656 GCCCCGCGCCCCGGGAGCGCAGG - Intronic
1119004187 14:70908498-70908520 GTGCGGAGCCCCGGGAGCGCGGG + Intronic
1119325781 14:73759057-73759079 CTGCGGCGGCGCGGGCGTGCGGG + Intronic
1121050470 14:90816406-90816428 CCGCGGCGTAACGGGAGCGCCGG + Exonic
1121342956 14:93115908-93115930 CCGCGGCGGCGAGGAAGCGGCGG + Intronic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122470734 14:101964439-101964461 TCACGGCGCCGCGCGTGCGCGGG - Intergenic
1122625730 14:103084506-103084528 CCCCAGCGCCGCGGGATCCCAGG - Intergenic
1122779127 14:104136289-104136311 GCGCGGCGCGGAGCGAGCGCAGG + Intergenic
1122919964 14:104875989-104876011 CCGCTGGGCCGTGGGAGTGCTGG - Intronic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1124971561 15:34494743-34494765 CCGTGCCGCCGAAGGAGCGCCGG - Intergenic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1126746438 15:51830128-51830150 CCGCGGCTCAGCGGGAGGGGAGG - Intronic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1128877611 15:71215082-71215104 CGGCGGCGCCCCGGGAGTGTGGG + Exonic
1129360932 15:75023661-75023683 TCGCGGCGGCGCGGGAGGGGAGG + Intronic
1129540344 15:76342847-76342869 CCGCGGCGCCGAGCGAGAGTGGG - Intergenic
1129817234 15:78565693-78565715 CCGCGCCCGCGCGGGACCGCGGG - Exonic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1129933691 15:79432179-79432201 TCCCGGGGCCGCTGGAGCGCGGG + Intergenic
1130362987 15:83207773-83207795 CCCGGGCGCGGCGCGAGCGCCGG + Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1130564540 15:84982135-84982157 CGGCGGCGCCGCGGACACGCTGG - Exonic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1132342352 15:101086516-101086538 CGGCGGAGCCGCGGCCGCGCAGG - Intergenic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1132900423 16:2251287-2251309 GGGCGGCGCCGAGGGAGGGCGGG - Intronic
1133029679 16:3004451-3004473 TCGGGCCGCAGCGGGAGCGCGGG - Intergenic
1135400343 16:22162538-22162560 ACGCAGCGCCGCGGGAGCCCGGG + Intergenic
1135404760 16:22190258-22190280 CCGTGGAGCCGCGGGGCCGCCGG - Exonic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1137788534 16:51155369-51155391 CAGCGGCGCCCCGGGGGCGGGGG + Intergenic
1140033848 16:71358603-71358625 GCGCGGCGCGGCGGGGGCGGCGG - Intergenic
1141132185 16:81444467-81444489 CCGCGCCCCCGCGGGTGCCCGGG - Intergenic
1142156314 16:88534246-88534268 CCGCGGCGACTCGGGCGCGGGGG - Exonic
1142513154 17:410519-410541 GGGCGGCGCCGCGGGCCCGCGGG + Exonic
1142683381 17:1562779-1562801 CCGCAGCGCCGCGCGGGGGCGGG + Exonic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143487441 17:7262526-7262548 CCCGCGCGCCCCGGGAGCGCGGG + Intronic
1143697527 17:8631085-8631107 CCGCAGCCTCGCGGGATCGCCGG - Intergenic
1144724636 17:17495823-17495845 CCAGGGCGCCCCGCGAGCGCCGG - Intronic
1144775528 17:17782939-17782961 CCGCGTCCCCGCGGCAGCCCCGG + Intronic
1145243607 17:21253326-21253348 GCGCGGCGGGGCTGGAGCGCGGG + Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1147200699 17:38799596-38799618 CCGGGGCGGGGCGGGAGGGCGGG - Exonic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1148060133 17:44830326-44830348 CCGCCGCGGCCCGGGAGCGGGGG + Intronic
1148081101 17:44968089-44968111 GCGCGGAGCCTGGGGAGCGCCGG + Intergenic
1148911384 17:50944816-50944838 CGGGGCCGCCGCAGGAGCGCAGG - Intergenic
1148930148 17:51120937-51120959 GCGGGGCGCCGCGGGAGGCCAGG + Intergenic
1149610532 17:57955335-57955357 CGGCGGCGCGGCTGGGGCGCGGG + Intergenic
1150643499 17:66964734-66964756 CCCCAGCGCTGCCGGAGCGCAGG + Intergenic
1151854360 17:76710695-76710717 CCGCGGGGCTGGGGGAGCTCGGG - Exonic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152601747 17:81265837-81265859 CTGCGGAGCCGTAGGAGCGCTGG + Intronic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1155054147 18:22170360-22170382 GTGCGGCGCCGCGGGGACGCCGG + Intronic
1156008431 18:32470448-32470470 TGGCGGCGGCGGGGGAGCGCGGG - Intronic
1157215049 18:45775609-45775631 CCGTGGCGGCGCGGCAGCTCGGG + Intergenic
1157473682 18:48008309-48008331 CGGCGGCCACGCGGGGGCGCTGG + Intergenic
1159040704 18:63320458-63320480 CCACCGCGCCGCGGCCGCGCGGG - Intergenic
1160024787 18:75208787-75208809 GCGCGGCGCGGCGCGAGCCCGGG + Intronic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160691051 19:460840-460862 CCGCGGCCCGGCGGCGGCGCGGG - Exonic
1160749577 19:727565-727587 CCAAGGCACTGCGGGAGCGCTGG + Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161808728 19:6459587-6459609 ACGCGGAGCGGCGGCAGCGCTGG - Exonic
1162737497 19:12754721-12754743 CCGCGGTGCTGACGGAGCGCAGG - Exonic
1163316303 19:16542647-16542669 GCGCGGCGCCGCGGAAAGGCTGG + Intronic
1163635031 19:18433706-18433728 CCACGGCGCCGGGGGAACTCTGG - Exonic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164834742 19:31349811-31349833 CCGTGGCGCGGCTGGAGCGGCGG + Intergenic
1165204519 19:34172454-34172476 CCGCGGCGCGGCGGCGGCGGCGG - Intergenic
1165305647 19:35000900-35000922 CCGCGGAGCCCTGGGCGCGCCGG + Intronic
1165349642 19:35268981-35269003 CTGCCGCGCGGCGTGAGCGCCGG + Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166091639 19:40513071-40513093 CGGCGGCGCGGCGAGAGCGGCGG + Exonic
1166100846 19:40570594-40570616 CCGGGGCGGAGCGCGAGCGCCGG - Exonic
1166780610 19:45340754-45340776 GCCCGGCGCAGCGGGAGCGGCGG + Exonic
1166790418 19:45395781-45395803 CCGCGGAGCCCAGCGAGCGCCGG + Exonic
1166807585 19:45496630-45496652 CCCCGTCGCCGCCAGAGCGCGGG + Intronic
1166836047 19:45668721-45668743 ACGTGGAGCCGCGGGGGCGCGGG + Intronic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
929604697 2:43226651-43226673 CTGCGGCGGGGCGGGCGCGCCGG + Intergenic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
931515904 2:63050633-63050655 CCGGGGCGGGGCGGGAGGGCGGG + Intronic
931763598 2:65436190-65436212 CGGGGGCGCCGCGGCAGCGGGGG - Intergenic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
933772823 2:85754730-85754752 CCGGGGCGCGTCGGGGGCGCAGG - Exonic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
934636185 2:95991973-95991995 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
934797464 2:97113453-97113475 CGGAGGTGCCGCGGGAGGGCGGG - Intergenic
934835947 2:97589986-97590008 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
936104530 2:109613746-109613768 CCGCGGGGGCCGGGGAGCGCGGG + Intronic
938496748 2:131801817-131801839 CCGCAGCCCCGCTGGAGGGCAGG + Intergenic
939969554 2:148644601-148644623 CCGCGGCGCTGCCGGCCCGCGGG - Intronic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940646785 2:156400308-156400330 TCGCGGCGCGGCCCGAGCGCTGG + Intergenic
941104868 2:161341075-161341097 CCGCGGGGCTGGGGGAGCTCGGG - Intronic
941816297 2:169799133-169799155 CGGCGGAGCCGAGGGGGCGCGGG + Intronic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
943639550 2:190343677-190343699 CCGCGGTCCCGCGGGAAAGCCGG + Exonic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
948645146 2:239400198-239400220 CCGGGGGGTCGCGGGAGGGCGGG - Intronic
948958821 2:241316021-241316043 CCGCAGCTCCTCGGGAGGGCCGG - Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1170756806 20:19212488-19212510 CGGCGGCGCGGCGGGGGCGGCGG - Intergenic
1172037339 20:32019244-32019266 CGGCGGCGGCGCGGGAAAGCCGG + Exonic
1175215806 20:57391305-57391327 CCGCCCCGCCCCGGGCGCGCGGG - Intergenic
1175439646 20:58981547-58981569 CGGCCGCGCCGCGGGACCCCGGG - Intronic
1175859707 20:62143637-62143659 CGGCGGCGCCGCGGGCCCGGAGG + Intergenic
1176042357 20:63072308-63072330 CCGCGGCCCCCTGGGAGGGCGGG - Intergenic
1176194640 20:63831458-63831480 GCGCCGCGCCGCGGGGTCGCAGG + Intergenic
1176207203 20:63895470-63895492 CCGCGGCGTCGCAGCAGCTCCGG - Intronic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1176548378 21:8211571-8211593 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176556270 21:8255777-8255799 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176567309 21:8394606-8394628 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176575209 21:8438819-8438841 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1177431738 21:20998443-20998465 CTGGGGCACCGCGGGAGCGGCGG + Exonic
1178497733 21:33101479-33101501 CCGGGGCGCAGCGGGAGCCATGG - Intergenic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1178915101 21:36701545-36701567 CCGCGGCCGCGCGGTAGGGCCGG - Intronic
1179150575 21:38805643-38805665 CGGAGGCGGCGAGGGAGCGCGGG - Intronic
1179437173 21:41369843-41369865 CCACGGCGGGGCGGGAGCGGGGG - Intronic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1180455568 22:15511035-15511057 CCGCAGCCCCGCTGGAGGGCAGG - Intergenic
1181574869 22:23787294-23787316 GCTCGGCCCCGCGGGAGCCCCGG + Intronic
1183912900 22:41092268-41092290 CCGCGTCGGCGCGGGCGTGCGGG + Exonic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1185309067 22:50143229-50143251 CAGCGGCGCCGCGGGTGCTGTGG + Intronic
1185313606 22:50169832-50169854 CCGCAGCACCCCAGGAGCGCGGG + Intergenic
1203253258 22_KI270733v1_random:127874-127896 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1203261313 22_KI270733v1_random:172955-172977 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
950487833 3:13283180-13283202 CCGCTGCCCCGCGGACGCGCCGG + Intergenic
950773589 3:15331915-15331937 CCGCGGTGCCGCGGCCGGGCAGG + Intronic
953439613 3:42906419-42906441 CCGCGCTGCCCCGGGCGCGCCGG + Exonic
954469008 3:50675413-50675435 CCTCGGCGCGGGGCGAGCGCGGG + Intronic
955688172 3:61564699-61564721 CCGCGACGCCGCTGGACCTCAGG + Intronic
956406335 3:68932326-68932348 CCGCCTCCCCGCGGGAGCCCCGG + Exonic
962588087 3:136862240-136862262 ACGCGGCGGCGGCGGAGCGCAGG + Exonic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
964720752 3:159765213-159765235 CCGCGGGCGGGCGGGAGCGCAGG - Intronic
967055639 3:185826148-185826170 CTGCGGCGAGGCCGGAGCGCTGG + Intergenic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968479508 4:827007-827029 ACGCGGCACTGCGGGAGAGCGGG + Intergenic
968593736 4:1472213-1472235 CCGCGGGGCAGCCGGAGCCCGGG + Intergenic
968594065 4:1473378-1473400 CCGGGGCGGTGCGGGAGCACTGG - Intergenic
968599853 4:1503738-1503760 CCGGGGAGCCGGGGGAGCCCGGG - Intergenic
969721297 4:8894221-8894243 CTGCGGAGCGGCGGGAGCGCAGG - Intergenic
971457812 4:26860800-26860822 CGGCGGCGGCGCGGGAGCTGGGG + Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
975139190 4:70902653-70902675 ACGCCGGGCCCCGGGAGCGCTGG - Intronic
981429801 4:144645878-144645900 CCGCGGCGAGGCGGGCGCGCGGG + Intergenic
981475288 4:145180825-145180847 CCGCGGCGCAGCGGCAGGGTTGG - Intergenic
982288794 4:153759937-153759959 CCGCGGGGCCTCGGGAGCCGAGG + Exonic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985064251 4:186105328-186105350 CAGCCGCGCCGCGGGAGCAGTGG + Intronic
986468866 5:8053498-8053520 CCGCTGAGCCGCGGGAACCCTGG + Intergenic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
988577876 5:32444383-32444405 CCGAGACGCCGAGGGAGGGCAGG + Intronic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
990383022 5:55233852-55233874 CCGGGTCGCTGCGGGAGCCCGGG + Intergenic
990955459 5:61333951-61333973 CTGCCGCGCCGCGGGGACGCGGG - Intronic
991436085 5:66597584-66597606 CAGCGCCACCGAGGGAGCGCGGG - Intronic
992042317 5:72848254-72848276 CCGCGGCGTTTGGGGAGCGCTGG + Intronic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992098175 5:73381586-73381608 CTGAGGCGCCGCGGGAGCGCAGG - Intergenic
992530195 5:77645608-77645630 CCGCGGCACCTCCGGACCGCTGG - Intergenic
996862629 5:128083626-128083648 GCGCGCCGCTGCGGGACCGCGGG + Intergenic
996948196 5:129094805-129094827 CAGCGGCGCCGGGGGCGCGGGGG + Exonic
997912431 5:137889324-137889346 CGGCTGCGCCGCAGGAGCCCGGG - Intronic
998435940 5:142108895-142108917 CCGCTGCGGCTTGGGAGCGCTGG - Exonic
998797521 5:145835497-145835519 CCGCGGGGCCCCGGGTGCTCTGG - Intergenic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003099038 6:3163120-3163142 CCGCGGCGCAGGGGGAGGGCGGG + Intergenic
1003552322 6:7109449-7109471 CCGCGGCCGCGCGTGAGTGCGGG + Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1004216935 6:13711763-13711785 CGGGGGCGACGCGGGAGCGCGGG + Intergenic
1005875507 6:30007433-30007455 CCGCGGCGGTCCAGGAGCGCAGG - Intergenic
1005965106 6:30721433-30721455 CCGGGGCGCCGTGGGCGCGCGGG + Intronic
1006043081 6:31271211-31271233 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006052674 6:31356305-31356327 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006071066 6:31498285-31498307 CCCCGGCGGAGCGGGAGCGGCGG + Intronic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1007072835 6:39049175-39049197 CCGCGGGGCAGCGGGTGCCCGGG - Intronic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1009437729 6:63636479-63636501 CCGCTGAGGCGCGGGCGCGCAGG + Intronic
1012996571 6:105981424-105981446 CCGCGTAGCGGTGGGAGCGCAGG + Intergenic
1014230353 6:118895213-118895235 CCACGGCCCCCGGGGAGCGCCGG - Intronic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1018670103 6:166169888-166169910 CCGCGACGCCGTCCGAGCGCAGG - Intergenic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019534945 7:1523931-1523953 CCGGGGCGCCCCGGGAGGGGTGG - Intergenic
1020107634 7:5429464-5429486 CTGGGGCGCCGCGGCAGGGCTGG - Intergenic
1020281945 7:6654407-6654429 CCGCGGAGCCACCGCAGCGCCGG + Exonic
1022094464 7:27130261-27130283 TCGCAGCGCCGCGGGGCCGCTGG + Exonic
1022107238 7:27205249-27205271 CCGGGGCGCTGGGCGAGCGCGGG + Intergenic
1022207752 7:28180230-28180252 CCGAGGTGCCGCGGGCGGGCGGG - Intronic
1023810210 7:43906241-43906263 CCGGGGCGCGGCGGGAGCGAGGG - Intronic
1024520906 7:50303904-50303926 CCGCAGCGCCGCGGCCGAGCCGG + Intergenic
1026471059 7:70694419-70694441 CCGCGGCGCGGCTGGAGAGGCGG + Intronic
1029453712 7:100656474-100656496 CGGCGGCGCCGTTGGAGCGGGGG - Intergenic
1029496345 7:100897079-100897101 CCGCAGCGCCTCGGGCACGCGGG + Intergenic
1029539310 7:101173437-101173459 GCGTGGCGCCCTGGGAGCGCGGG - Exonic
1029640820 7:101817602-101817624 CCGCGGCGCCGGGACAGCCCCGG + Intronic
1029834760 7:103297494-103297516 CCGCGGCGCGGCGGCGGCTCTGG + Exonic
1031025200 7:116672258-116672280 CCGCGGCGGCCCGGGCGCGTTGG - Intergenic
1031629892 7:124033146-124033168 CCGCGGTCCCGCGGCAGCGGGGG + Intergenic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1033406157 7:141073162-141073184 CGGAGGCGTCGCGGGAGAGCCGG + Intergenic
1033477165 7:141702115-141702137 ACGCGGCGCCGCTGCTGCGCTGG - Exonic
1034197910 7:149262259-149262281 CCGGGGCGGCGCGGCAGCGACGG - Exonic
1034422382 7:150996466-150996488 CCGGGGGGCCGGGGGAGGGCCGG - Exonic
1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG + Intronic
1037876664 8:22551974-22551996 CCGAGGCCGCCCGGGAGCGCAGG - Exonic
1039476563 8:37841953-37841975 CGGGGGCGCGGCGGGGGCGCTGG + Exonic
1039531837 8:38269293-38269315 CTGGGGAGCCGCCGGAGCGCGGG - Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1041658360 8:60376550-60376572 CCGTGGGGCCTCGGGAGCCCTGG + Intergenic
1042307175 8:67343856-67343878 TCCCGGCGCCGCGGCAGCTCTGG - Intergenic
1043563477 8:81522256-81522278 CAGCGGCGGCGCTGGAGCGGCGG + Intergenic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1045489270 8:102656416-102656438 CCGCGGCACGGCGTGAGCGGGGG - Intergenic
1045510150 8:102807166-102807188 CGGGGGCGCCTCGGGCGCGCTGG - Intergenic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049643926 8:143727754-143727776 CCGAGGCGGAGCCGGAGCGCAGG - Exonic
1049651504 8:143771862-143771884 AGGCGGCGCAGCGGGAGCGGCGG + Intergenic
1056154056 9:83817568-83817590 CCGGGGAGCCGCGGGAGAGGCGG - Exonic
1056676891 9:88683464-88683486 CCCCGGCGCCGCGGGAGGAGAGG - Intergenic
1057152962 9:92809952-92809974 CCGCGGCTCCGAGGGTGCCCGGG - Intergenic
1057490460 9:95516268-95516290 CCGCCTGGGCGCGGGAGCGCGGG - Intronic
1059145550 9:111896681-111896703 CGGCGCCGCAGCGGGCGCGCGGG + Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1060192035 9:121599510-121599532 CCGGGTGGCCGCGGGAGCCCGGG + Intronic
1060996558 9:127877551-127877573 CAGCGGCACCGGGGGAGGGCGGG - Intronic
1061450479 9:130664616-130664638 CCCCGGCGCCGGGGGACGGCCGG - Exonic
1062544111 9:137054064-137054086 GGGCGGGGCCGCGGGACCGCGGG + Intergenic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062596762 9:137302994-137303016 CCGGGGCGCAGCGGGAGGGTCGG + Intergenic
1203469660 Un_GL000220v1:111021-111043 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1203477481 Un_GL000220v1:154993-155015 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1187281291 X:17860477-17860499 CGTCGGCGCCCCGGGAGCCCCGG - Intronic
1187826172 X:23334724-23334746 CCGCGGCTCCGGGAGAGCTCAGG + Exonic
1188004079 X:25005479-25005501 CCGCGGCGGCGCGGGTGGCCCGG - Intronic
1190862550 X:54358203-54358225 CCTCGGCGCCGCGGGAGAGAGGG + Intronic
1192274598 X:69616349-69616371 CAGCAGCGCCGCGGGAGCGAGGG + Exonic
1192491033 X:71577911-71577933 GCGGGGGGACGCGGGAGCGCAGG - Intergenic
1196918242 X:120561103-120561125 ACGCGGCGCCGAGGGAGGGGCGG + Intronic
1197753610 X:129981016-129981038 CGGCGGCGCGGCGGCAGCGAAGG + Intergenic
1200093830 X:153648092-153648114 AGGCGGCGCAGCAGGAGCGCCGG - Exonic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic