ID: 1059179596

View in Genome Browser
Species Human (GRCh38)
Location 9:112199385-112199407
Sequence TAGAATAAGTAGGAGTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059179596_1059179599 -8 Left 1059179596 9:112199385-112199407 CCAGCCTACTCCTACTTATTCTA No data
Right 1059179599 9:112199400-112199422 TTATTCTATGACACCCACTCAGG No data
1059179596_1059179602 8 Left 1059179596 9:112199385-112199407 CCAGCCTACTCCTACTTATTCTA No data
Right 1059179602 9:112199416-112199438 ACTCAGGTTTCCCCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059179596 Original CRISPR TAGAATAAGTAGGAGTAGGC TGG (reversed) Intergenic
No off target data available for this crispr