ID: 1059180158

View in Genome Browser
Species Human (GRCh38)
Location 9:112204423-112204445
Sequence CTGGCTATTCAGGCTTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059180154_1059180158 28 Left 1059180154 9:112204372-112204394 CCTTGTGGTATAGTTTGAAGTTG 0: 26
1: 527
2: 1518
3: 14391
4: 7338
Right 1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG No data
1059180156_1059180158 -7 Left 1059180156 9:112204407-112204429 CCTTCAGCTTTGTTCTCTGGCTA No data
Right 1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059180158 Original CRISPR CTGGCTATTCAGGCTTTTTT AGG Intergenic
No off target data available for this crispr