ID: 1059180442

View in Genome Browser
Species Human (GRCh38)
Location 9:112207371-112207393
Sequence GCACTAAGTAGACCACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059180442_1059180445 0 Left 1059180442 9:112207371-112207393 CCTTCTTGTGGTCTACTTAGTGC No data
Right 1059180445 9:112207394-112207416 CAGGTTTTTTGTATTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059180442 Original CRISPR GCACTAAGTAGACCACAAGA AGG (reversed) Intergenic
No off target data available for this crispr