ID: 1059181480

View in Genome Browser
Species Human (GRCh38)
Location 9:112217129-112217151
Sequence CACTGCTGACACCTTGATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059181479_1059181480 4 Left 1059181479 9:112217102-112217124 CCAAGGAAAGGCATTGGAAGAAA No data
Right 1059181480 9:112217129-112217151 CACTGCTGACACCTTGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059181480 Original CRISPR CACTGCTGACACCTTGATCG TGG Intergenic
No off target data available for this crispr