ID: 1059184171

View in Genome Browser
Species Human (GRCh38)
Location 9:112251177-112251199
Sequence AAGAGTGGCAATCAGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059184167_1059184171 -1 Left 1059184167 9:112251155-112251177 CCAAGAAGCCTCTACTTTGACAA 0: 1
1: 0
2: 0
3: 21
4: 177
Right 1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1059184169_1059184171 -9 Left 1059184169 9:112251163-112251185 CCTCTACTTTGACAAAGAGTGGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059184171 Original CRISPR AAGAGTGGCAATCAGGTGTA AGG Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
915705034 1:157835775-157835797 AAGAGTGGCCGTGAGGGGTATGG + Intronic
915915583 1:159938501-159938523 AAGAGTGGGATTGAGGTGTCTGG - Intronic
919065607 1:192689534-192689556 AAGAGTGGCTATCAGGAGCATGG - Intergenic
919472307 1:197994883-197994905 GAGAGTGGCAAGCAAATGTAAGG + Intergenic
919838052 1:201590227-201590249 AAGTGAGGTAATCAGGTGAATGG + Intergenic
921175366 1:212588672-212588694 GGGAGTGGGAATCAGGTGTGGGG - Intronic
923027744 1:230219459-230219481 AAGAGTGGCAATGAGAGGAAGGG - Intronic
1063840661 10:10068702-10068724 AAGATTGGCCATAAGGTGAAAGG + Intergenic
1066764836 10:38793284-38793306 AAGAGTGGAAATGAATTGTATGG - Intergenic
1069273154 10:66556084-66556106 AAAAGTGGCCACCAGGTGTATGG + Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1079348441 11:19672786-19672808 AACAGTGGGAATCAGGGGTCAGG + Intronic
1082773277 11:57225627-57225649 AGGAGTGGCAAACAGGAGAATGG + Intergenic
1084292120 11:68179462-68179484 AAGAGTGGGGAACAGGTGTGTGG - Intronic
1086894120 11:92292661-92292683 AAAAGAGGCATTTAGGTGTAAGG + Intergenic
1086917772 11:92550745-92550767 AAATGTGGCAACCAGGTGAAAGG - Intronic
1087368855 11:97255290-97255312 GAGAATGGTAATCAGGTATAAGG + Intergenic
1091198351 11:133750844-133750866 GAGAGTGGCAGGAAGGTGTAGGG + Intergenic
1092084709 12:5746507-5746529 CAGAATGGAAATCAGGTCTAGGG + Intronic
1092745521 12:11668985-11669007 AAGAGTTGCAAAGAGTTGTAGGG - Intronic
1092986383 12:13849948-13849970 AAGAGGGGTATTCAGGTGTTTGG - Intronic
1093849695 12:24020513-24020535 AAGTGTGGCAATCAGGGCTAAGG + Intergenic
1096674606 12:53219858-53219880 AAGAGTGGAACTGAGGTGCAAGG - Intronic
1102128179 12:110502362-110502384 ATGAGCGGCAGTCAGGTGAAAGG + Exonic
1103593356 12:122007804-122007826 AAGAGTGCCGGTCAGGTGTTTGG - Intergenic
1112126767 13:96476916-96476938 AAGAGTTGAAATCAATTGTAAGG + Intronic
1112728674 13:102334468-102334490 AAGAGTGGCCATCATCTGCATGG - Intronic
1119964015 14:78893044-78893066 AATAGGAGCAATCAGGGGTAGGG - Intronic
1120106067 14:80496323-80496345 AAGAGTTGCATTCAGGTTCATGG + Intronic
1121119209 14:91365265-91365287 ATGAGTGGCAGGCAGGTGTCTGG + Intronic
1121873773 14:97432673-97432695 AATAGTAGCAAACAGGTGAAAGG - Intergenic
1124448705 15:29764596-29764618 AAGAGTGGTATTCAGGAGTGAGG + Intronic
1128491269 15:68148219-68148241 AAGAGTTGCAATCAGGTGAAAGG + Intronic
1130192451 15:81750017-81750039 AAGAATGGCGAGCAGGTGTGGGG - Intergenic
1131122330 15:89830338-89830360 GAGGGTGGCAATCAGGAGTTTGG - Intergenic
1132473126 16:117974-117996 AGGAGTGGCAGTCAGGGGTAGGG - Intronic
1138925767 16:61589631-61589653 ATGAGTGGGAATCAGGAGTTAGG + Intergenic
1139558738 16:67728702-67728724 AAGGGTGGGAATCAGGTGACAGG - Intronic
1149389880 17:56178032-56178054 AAGACTGGCAATCAATTTTAAGG - Intronic
1153469150 18:5423862-5423884 AAGAGTGACAATTTGGTGTTGGG + Intronic
1155220293 18:23679160-23679182 AAGAGTGGTATTCAGGGGTAGGG + Intergenic
1156091058 18:33469907-33469929 AAGAGAAGCAATCAGCTCTAGGG + Intergenic
1157562563 18:48659207-48659229 TAGAGTGGCAATAAGGAGTGCGG + Intronic
1158344660 18:56504097-56504119 CAGAAAGGCAATCAGGTGAAGGG - Intergenic
1159671507 18:71226608-71226630 AGGAGTGGCAATAAGGTAAATGG - Intergenic
1160430861 18:78811738-78811760 AAGAGTTGCATCCAGCTGTAAGG - Intergenic
1161578260 19:5066721-5066743 AAGGGTGGCTACCAGGTATATGG + Intronic
1163094072 19:15042874-15042896 AAGAAAGGCAACCTGGTGTAAGG - Intergenic
1163456769 19:17411336-17411358 AAGAGGGGAAATTGGGTGTAGGG - Intronic
1164592416 19:29513895-29513917 GAGAGGGGCAATCAGGAGGAAGG + Intergenic
926067696 2:9857472-9857494 AAGAGTTGCCATCAGCTGAAGGG + Intronic
926326486 2:11788623-11788645 AAGAGGGGCAACCACGTGCAAGG - Intronic
926394437 2:12426624-12426646 AAGTGTGGCAAGATGGTGTAGGG + Intergenic
926579665 2:14621462-14621484 CAGAGAGTCAATCAGATGTATGG + Intergenic
929036123 2:37693720-37693742 AAGATTGGCAATCAAGCGAATGG + Intronic
929496978 2:42453474-42453496 ACGAATGGCAAACAGGTATATGG - Intronic
932560318 2:72862313-72862335 AAGAGGGGCACTCAGGTGGCTGG - Intergenic
935309027 2:101764709-101764731 ATGAGTGGCAAGAAGGTGCAGGG - Intronic
935336911 2:102024537-102024559 AAGACTGACAATCCCGTGTAAGG + Exonic
943304533 2:186243397-186243419 AGGAGTGGCAGTAAGGTATAAGG + Intergenic
948013736 2:234671138-234671160 AAGAATGGCAAGCAGATGTGGGG + Intergenic
948573168 2:238930162-238930184 GAGAGAGGCAATCAGGAATAAGG - Intergenic
1168737179 20:150966-150988 AAAAGTGGCTAACAAGTGTATGG - Intergenic
1169342424 20:4806319-4806341 TGGAGTGGAAATCAGGTGAACGG + Intronic
1169543899 20:6631031-6631053 AGGAGTGGCAATTAGGAGTAGGG - Intergenic
1169842424 20:9954711-9954733 AAGAGTGGGAATTAGGTTAATGG - Intergenic
1170348615 20:15415818-15415840 AAGAATGACAATCTAGTGTATGG + Intronic
1171467099 20:25337317-25337339 CAGTGTGGCAAACAGGTGGAAGG + Intronic
1172412144 20:34732946-34732968 AAAAGTGGCAACAAGGTGGATGG - Intronic
1175035622 20:55998203-55998225 AAGACTGGCAACCAGGTCTAAGG - Exonic
1176282423 20:64321660-64321682 AAGAAAGGGAATCAGGAGTAAGG - Intergenic
1177857408 21:26415243-26415265 TAGAGTGGCTGTGAGGTGTATGG + Intergenic
1179386685 21:40950029-40950051 AAGAGTGGCATTCATTTCTAAGG - Intergenic
1180630922 22:17229449-17229471 TAGAGTGGAAATCAGGTTTCTGG - Intergenic
1184478888 22:44736019-44736041 AAGAGTGGCCACCAGGTGGCGGG - Intronic
1184921918 22:47611284-47611306 AATAGGGGAAATCAGGTGTGGGG - Intergenic
949780859 3:7686232-7686254 AAGAGTGGGCATGATGTGTATGG + Intronic
953468813 3:43149353-43149375 AAGAGTGGCAATGAAGGGAAAGG - Intergenic
954819148 3:53309894-53309916 AAGATTGGCAATCAAGGGCAGGG - Intronic
955694912 3:61626121-61626143 AAGAGTGTGATTCAAGTGTAAGG + Intronic
956542266 3:70354046-70354068 GAGAGTGGGAGTCAGGGGTAAGG + Intergenic
956889918 3:73602562-73602584 AAGAGTGGCAATAGGGTAAAAGG + Intronic
958144166 3:89602330-89602352 GGGAGTGGCACTCAGGTGTCAGG + Intergenic
962222174 3:133573482-133573504 AAGAGAGCCAATCAGGTGCCAGG - Intergenic
962258387 3:133887350-133887372 GAGGGTTGCACTCAGGTGTAGGG + Intronic
964708154 3:159643010-159643032 AAGAGTGGTAGTCAGATCTAGGG + Intronic
965895425 3:173570112-173570134 AAGAGTGGCAGTGAGGGGTGAGG + Intronic
970012813 4:11479303-11479325 AAGAGTGCCAACCTGGTGTAGGG - Intergenic
970833491 4:20370995-20371017 AACAGTGGCAATCTGTTGAAAGG - Intronic
978562354 4:110046502-110046524 AAAAGTGTCAATCAGGAGGAAGG + Exonic
981162947 4:141521001-141521023 AAGAGTGGCATAAAGGTGAAAGG + Intergenic
987786390 5:22505483-22505505 AATAGTGATAATCAGGTGTGAGG - Intronic
992217393 5:74539329-74539351 AGGAGGGGCAATCAGGAGTTGGG + Intergenic
996811092 5:127517343-127517365 AAGAGTGCCACTCTCGTGTAAGG + Intergenic
998782784 5:145676669-145676691 AAGAGTGACAATAAGGGATATGG + Intronic
999955639 5:156698460-156698482 AAGTGTAGCAATCAGCTGGAAGG + Intronic
1005385645 6:25281485-25281507 TAGAGTGGAAATAAGGTGTCTGG + Intronic
1007147133 6:39647375-39647397 AAGAGGGGCAGGCAGGTGTATGG + Intronic
1007284327 6:40736785-40736807 AAGAGTGGGGATCAGGTGGCCGG + Intergenic
1011529410 6:88303881-88303903 AAGAGTGGCCATGAGTTGTTAGG + Intergenic
1011907903 6:92395129-92395151 AATAGGGGCAATTAGATGTAAGG - Intergenic
1022087645 7:27084472-27084494 AAGCGTGGCAGTCAGATCTAGGG + Intergenic
1028768126 7:94583575-94583597 AAGAGAGGCTGTCATGTGTATGG + Intergenic
1034500898 7:151450081-151450103 CTGAGTGGCATTCAGTTGTATGG - Intergenic
1035667084 8:1387451-1387473 AAGATTGGCAGTCTGGTGCACGG + Intergenic
1037456088 8:19065679-19065701 AAGAGTGGCATGCCTGTGTAAGG - Intronic
1037753384 8:21696828-21696850 AAGAGAGGAAACCAGGTGAAGGG + Intronic
1041981484 8:63866359-63866381 AAGAGTTGGAATTAGATGTATGG - Intergenic
1045659288 8:104419945-104419967 AATAGTGGCAACCAGCTGTGGGG + Intronic
1048913980 8:139164748-139164770 AGGAGTGGCAATCTGGTTTTTGG + Intergenic
1056608515 9:88108066-88108088 AACAGTGGCAATTAGTAGTAGGG - Intergenic
1056782428 9:89560899-89560921 GATAGTTGCAATCAGATGTACGG + Intergenic
1057459773 9:95250743-95250765 AGGGGTGGCAATGAGGTGGAAGG - Intronic
1057860089 9:98634124-98634146 AGGAGTGCCTATTAGGTGTAGGG + Intronic
1058913365 9:109541672-109541694 AAGAGAGGCAGTGAGGTGAAGGG + Intergenic
1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG + Intronic
1059879430 9:118673675-118673697 AAGAGAGACAATATGGTGTAAGG + Intergenic
1061728730 9:132596978-132597000 GAGAATGGCACTCAGGTGTGAGG + Intronic
1188089846 X:25951240-25951262 AAAAGTAGCAAGCAGGTATATGG - Intergenic
1192221017 X:69197386-69197408 AAGATTGGCAAGCAGGTTGATGG + Intergenic
1192350832 X:70355020-70355042 AAGAGGGGCCATCTGGTCTATGG + Intronic
1193537177 X:82729639-82729661 AAAGGTGGCAATGAGGTGTGAGG - Intergenic
1194324209 X:92491743-92491765 AACAGTGGTTATCAGGCGTAAGG - Intronic
1196257696 X:113541218-113541240 AAGAGTGGCAAACAGGTTATGGG - Intergenic
1197443346 X:126516868-126516890 AAGAGAGGAAATCAGTTGAAAGG + Intergenic
1197622885 X:128770935-128770957 AAGAGTGGAATCTAGGTGTAGGG - Intergenic
1198503882 X:137281743-137281765 AAAATTGGCAATTAGGTGAAAGG - Intergenic
1200632310 Y:5604891-5604913 AACAGTGGTTATCAGGCGTAAGG - Intronic