ID: 1059186860

View in Genome Browser
Species Human (GRCh38)
Location 9:112282087-112282109
Sequence GATTACATGATGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059186860_1059186864 -3 Left 1059186860 9:112282087-112282109 CCACCCACCTTCATCATGTAATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1059186864 9:112282107-112282129 ATCTAAACATTATTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059186860 Original CRISPR GATTACATGATGAAGGTGGG TGG (reversed) Intronic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
905066160 1:35185338-35185360 GATGGACTGATGAAGGTGGGTGG - Intronic
907410496 1:54280097-54280119 GGTCACATGATGGTGGTGGGAGG - Intronic
907699596 1:56772079-56772101 GATTACTTTATGAAGGGGGAGGG - Intronic
912124026 1:106510720-106510742 GATCACATGATGAGAGAGGGAGG + Intergenic
917687139 1:177428464-177428486 GATGAACTGATGAAGGTGAGGGG + Intergenic
921117266 1:212105037-212105059 GATTACTTGATAAAGCAGGGTGG + Intronic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
921811084 1:219515381-219515403 GGCTACATGATGAAAGTTGGGGG + Intergenic
923203155 1:231732151-231732173 GGCTACATGAGAAAGGTGGGTGG + Intronic
923788407 1:237090386-237090408 GATTACATGAGGGAGGCAGGGGG + Intronic
923917987 1:238530307-238530329 GATGACATGTTGATGGTGGCAGG - Intergenic
1063844752 10:10114234-10114256 GATTACTAGATGAGGGAGGGAGG - Intergenic
1063915821 10:10880990-10881012 TGTGACATGAAGAAGGTGGGTGG - Intergenic
1064062974 10:12154820-12154842 GAGTACAAAATGAGGGTGGGCGG + Intronic
1067232500 10:44421920-44421942 GTTTACATGTGGCAGGTGGGTGG - Intergenic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1073706172 10:105986932-105986954 TCTTAAATGATGAAGGAGGGAGG + Intergenic
1073930135 10:108566389-108566411 GCTGCCATGATGAAGGTGGCGGG + Intergenic
1074794658 10:116930386-116930408 GCTTACTTGATGATGGAGGGTGG - Intronic
1075604468 10:123794314-123794336 GCTTATATGATGAATGTGTGGGG - Intronic
1079075830 11:17385029-17385051 TATTTCATGATGAGGGTGGGGGG + Intergenic
1079925051 11:26483586-26483608 GGAAACATGATCAAGGTGGGAGG - Intronic
1080298198 11:30754097-30754119 GAATACATGATGAGGCTGAGGGG - Intergenic
1080792581 11:35535056-35535078 GAGTGCAAGCTGAAGGTGGGTGG + Intergenic
1084415755 11:69032156-69032178 GCGTACATTATCAAGGTGGGAGG - Intergenic
1086382429 11:86270687-86270709 GATTTCCTTATGAAGGTGCGAGG + Intronic
1086563297 11:88194037-88194059 GATTAGATGATGTAGGTATGTGG + Intergenic
1086947087 11:92853988-92854010 GATGACATGTTGATGGTGGCAGG - Intronic
1089936731 11:122371897-122371919 TATTACATGAGGAAGGTTAGTGG - Intergenic
1090489382 11:127144747-127144769 GATAAAATGATGGAGGTGAGGGG + Intergenic
1093183067 12:15988766-15988788 GACAACATGATGATGGTGGTGGG - Intronic
1093433228 12:19107028-19107050 GATTATATTGTGAAGGTGGCTGG + Intergenic
1096096375 12:48938323-48938345 GATTAAGGGAAGAAGGTGGGAGG - Exonic
1098492152 12:71093961-71093983 GAATAAAATATGAAGGTGGGAGG - Intronic
1099406442 12:82269354-82269376 GAGTATATAATGAAGATGGGTGG + Intronic
1100541830 12:95564618-95564640 GATTACATAATTAAGTAGGGGGG - Intergenic
1101460776 12:104891000-104891022 GAGTAGATGATGAGTGTGGGAGG - Intronic
1106013467 13:25846507-25846529 GATGACATGAAGCAGTTGGGGGG + Intronic
1107594321 13:41946910-41946932 GATTAGATTATGAGGATGGGCGG - Intronic
1108395948 13:49991819-49991841 GATTTCATAAGGGAGGTGGGTGG - Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1111781738 13:92736409-92736431 GACTTAATGAAGAAGGTGGGTGG - Intronic
1112313809 13:98343495-98343517 GATTAATTGAATAAGGTGGGAGG + Intronic
1112785656 13:102948856-102948878 GATAACATGGTGGTGGTGGGGGG + Intergenic
1114418639 14:22561063-22561085 CATTGCATGAAGGAGGTGGGTGG - Intergenic
1115771909 14:36672578-36672600 GAATAAATAATGAAGGTGGCAGG + Intronic
1118654111 14:67928530-67928552 TATTAAAGGACGAAGGTGGGAGG - Intronic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1122825064 14:104366671-104366693 GCAGCCATGATGAAGGTGGGAGG + Intergenic
1123793007 15:23741783-23741805 GAATACAAGATGGAGGAGGGAGG - Intergenic
1124630474 15:31333994-31334016 GATCACATGGTTAAGGTGGGCGG + Intronic
1127183370 15:56450072-56450094 GATTACAAAAAGAAGGTAGGAGG - Intronic
1128519131 15:68364163-68364185 GATTAGATGAAGAAGGCTGGAGG - Intronic
1132013847 15:98299055-98299077 GATTACATGATTATGGAGGCTGG - Intergenic
1132521501 16:392105-392127 GCTTACATCATGAAGTTGTGGGG - Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1135877205 16:26213771-26213793 GCTTACTTGAGGAAGGAGGGTGG - Intergenic
1138250257 16:55496805-55496827 GATTCCATGATGGGAGTGGGAGG - Intronic
1139612693 16:68070226-68070248 GAGTACATGATGAAGACAGGAGG - Intronic
1139750785 16:69107679-69107701 GCTTACATGCTGAAGGGGCGCGG - Exonic
1141802451 16:86320041-86320063 GCTCACATGCCGAAGGTGGGAGG - Intergenic
1142417821 16:89952666-89952688 TATTACCTGATGACTGTGGGTGG - Intronic
1144809230 17:17988084-17988106 GACAACATGATGAACGTGAGTGG + Exonic
1145842834 17:28010542-28010564 GATTCCAGAATGAATGTGGGAGG + Intergenic
1146138059 17:30340595-30340617 GTTTGCCTGATGACGGTGGGTGG - Intergenic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1148896766 17:50843436-50843458 GCTTCCCTGATGAAGGTGTGAGG + Intergenic
1149922788 17:60675071-60675093 GGTTACAGGATGAAGGTGAGAGG - Intergenic
1150437909 17:65168323-65168345 GAGCACAGGATGGAGGTGGGAGG - Intronic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153608152 18:6855107-6855129 GATGGCATGTTGAAGGTGGGAGG + Intronic
1156924832 18:42563645-42563667 GAGTACATGGTGAAGGGGAGTGG + Intergenic
1161946578 19:7440981-7441003 GGTTTCATGGTCAAGGTGGGAGG - Intronic
1163267151 19:16228194-16228216 GAGTACATGATCAAGGTGCGTGG + Exonic
1167492558 19:49800985-49801007 GAGAACATGGTGAAGGTTGGCGG + Exonic
1168306847 19:55440548-55440570 GGCTACATGATGAAGGGGCGTGG + Intronic
928523883 2:32119385-32119407 GATTATATCAAGAAGGTGAGTGG + Intronic
928581789 2:32715369-32715391 GATCACATGTTGTAGGTGTGTGG + Intronic
929478308 2:42276394-42276416 GAGTACATGATGACTGAGGGTGG - Intronic
931551086 2:63447093-63447115 GATACCTTGTTGAAGGTGGGGGG + Intronic
933107135 2:78344748-78344770 GATCACATGCTGTAGGTGTGTGG + Intergenic
935699759 2:105801358-105801380 GATGACATGGGGAAGGGGGGAGG - Intronic
935845377 2:107160519-107160541 GATTACATTATAAAGATGTGTGG - Intergenic
936020947 2:108994349-108994371 GCTTACATAATGGAGGTGGTGGG - Intergenic
937315937 2:120932106-120932128 GCTTCCATGATGAATGTGGTTGG + Intronic
938374902 2:130798717-130798739 TATCACATGTGGAAGGTGGGTGG - Intergenic
939341009 2:140895925-140895947 GAGTACAGGATGGAGGTGGGGGG + Intronic
943052535 2:182933634-182933656 GATCACCTGAGCAAGGTGGGTGG - Intronic
943226490 2:185185315-185185337 GATGACATGTTGATGGTGGCAGG + Intergenic
943327264 2:186515696-186515718 GATTACATAATCAAACTGGGGGG - Intergenic
944299272 2:198104190-198104212 GACTACATGAGGATGGAGGGTGG - Intronic
945435333 2:209810930-209810952 GATTACAGCATGGGGGTGGGGGG + Intronic
948509090 2:238451109-238451131 GTGTACATGATGCACGTGGGTGG + Exonic
1170869712 20:20194595-20194617 GATTAAATGATCAATTTGGGTGG + Intronic
1171425478 20:25046167-25046189 GATCACTTGAGGACGGTGGGTGG - Intronic
1172438670 20:34949515-34949537 GATTAGATGATTGAGATGGGGGG - Intronic
1174034400 20:47659272-47659294 GTTCTCATGATGAGGGTGGGGGG - Intronic
1174322538 20:49753283-49753305 GGCTACAGGATGGAGGTGGGAGG - Intergenic
1177156610 21:17507227-17507249 GAACACATGCCGAAGGTGGGCGG - Intergenic
1177382656 21:20365789-20365811 GATGACTTGATGGAGATGGGTGG - Intergenic
1177769051 21:25494084-25494106 AATTACATGATGTGGGAGGGAGG + Intergenic
1179159952 21:38886720-38886742 GATTACCAAATGAAGGAGGGAGG - Intergenic
1181575773 22:23793672-23793694 CATTACCTGAGGTAGGTGGGGGG - Exonic
1182657657 22:31903290-31903312 GTTTACGTGTGGAAGGTGGGGGG - Intronic
1183142387 22:35955055-35955077 GATTACATTGTGAAGGGAGGTGG - Intronic
1184878115 22:47288361-47288383 GATGGAAGGATGAAGGTGGGTGG - Intergenic
1185178781 22:49347467-49347489 GATGAGCTGATGAAGGTGAGGGG + Intergenic
950626725 3:14252926-14252948 GATTAGAGGATGCAAGTGGGTGG - Intergenic
951404413 3:22277819-22277841 CATTACATGATGAAAGAGCGAGG + Intronic
952532203 3:34274233-34274255 GATTAAATGCTGATGGTGGGAGG + Intergenic
952950856 3:38523929-38523951 GATTACCTTATAAAGGTGTGAGG - Exonic
953015788 3:39074799-39074821 GAGTCCATGATGAAGGTGTTTGG + Exonic
956467157 3:69530415-69530437 GATTACATGATGAGAGAGGAGGG - Intronic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
959348379 3:105228804-105228826 GAATACATGAAGGAAGTGGGAGG - Intergenic
961584616 3:127911623-127911645 AAATACATGATGAAGGAGGATGG + Intergenic
962410663 3:135139206-135139228 GATTACATGACTAATCTGGGAGG - Intronic
964598723 3:158470484-158470506 TGTTACAAGATGATGGTGGGGGG + Intronic
964786716 3:160403514-160403536 AATTACATAATGAAATTGGGAGG + Intronic
966064404 3:175800555-175800577 GAGTACATGATGAGGGGTGGTGG - Intronic
968805506 4:2769080-2769102 GGTTTCATGCTGAAGGTGGGAGG + Intergenic
969967536 4:11012806-11012828 GATTCCTTGATGAAAGTAGGGGG + Intergenic
974693491 4:65333455-65333477 GATTTCAAGAGTAAGGTGGGAGG - Intronic
976772975 4:88674230-88674252 GGTTACAGGAAGAGGGTGGGGGG + Intronic
978883772 4:113741781-113741803 AAGTACATGATGATGTTGGGAGG - Intronic
980490884 4:133526753-133526775 GATTACATGCTGCAGATGAGGGG + Intergenic
982802630 4:159723179-159723201 GATGACATGTTGATGGTGGCAGG - Intergenic
983798816 4:171901509-171901531 GATTACATGAGGAAGGGGAGTGG - Intronic
984549021 4:181138824-181138846 GATTAAAAGAAGAAGGGGGGTGG - Intergenic
985004545 4:185521091-185521113 GATAAATTGATGACGGTGGGAGG + Intronic
988297505 5:29384634-29384656 GATAAGATTATGAGGGTGGGAGG - Intergenic
988333618 5:29875802-29875824 GTTTATATGATGAAGGCTGGTGG + Intergenic
991056460 5:62325971-62325993 GATTACTAGAGGAAGGAGGGTGG + Intronic
991121285 5:63017474-63017496 GATTACATGAAGATGGAGGGTGG - Intergenic
993689376 5:90980507-90980529 GACTACATTGTGAGGGTGGGTGG + Intronic
993971027 5:94420056-94420078 CATGACAAGATCAAGGTGGGGGG + Intronic
994246962 5:97489179-97489201 GATGACATGTTGATGGTGGGAGG - Intergenic
995137521 5:108696079-108696101 GATTAGTTGGTGGAGGTGGGGGG - Intergenic
997581669 5:135021141-135021163 GATTCCATGATCATGGTGGCTGG + Intergenic
998999183 5:147901169-147901191 GATTACGTGATGAAGGTAAGAGG - Intronic
1002289331 5:178188881-178188903 GACTTGATGAGGAAGGTGGGAGG + Intergenic
1004457147 6:15801650-15801672 CCTTTCAGGATGAAGGTGGGGGG + Intergenic
1004720854 6:18266209-18266231 GATGACATGTTGATGGTGGGAGG - Intergenic
1005209723 6:23446718-23446740 CATTACATGGTGAATGCGGGAGG - Intergenic
1006593934 6:35179140-35179162 GTTTACATGATGTGGGTGTGTGG - Intergenic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1009197802 6:60708284-60708306 GATGAAATGAAGAAGGTGAGAGG + Intergenic
1010534564 6:77011446-77011468 GATGACATGTTGATGGCGGGAGG + Intergenic
1012709525 6:102581858-102581880 GTTCACATGTTGACGGTGGGAGG + Intergenic
1013782934 6:113748798-113748820 GATATCATGTTGAGGGTGGGAGG - Intergenic
1014774307 6:125490918-125490940 GATTACCTGGTGCTGGTGGGAGG + Intergenic
1016133452 6:140507169-140507191 CCTTACAGGATCAAGGTGGGAGG - Intergenic
1018438521 6:163786088-163786110 GATTATATGATGAGGGAGAGAGG + Intergenic
1018517820 6:164606212-164606234 GATTAGAAGATGAAGGAAGGGGG + Intergenic
1019068648 6:169323554-169323576 CATTACATGATGAAGGGGTAAGG - Intergenic
1019740579 7:2671015-2671037 GAGTTCAGGATGAGGGTGGGAGG + Intergenic
1022893154 7:34721481-34721503 GATGTGATGCTGAAGGTGGGAGG - Intronic
1024857064 7:53794615-53794637 GATGACATGTTGATGGTGGCAGG - Intergenic
1025800466 7:64782155-64782177 GATTACTTGAGCCAGGTGGGTGG - Intergenic
1026481156 7:70780681-70780703 AATTACCTGAGGAAGGTTGGGGG - Intronic
1027800836 7:82747118-82747140 GATTACATGATCCAAGTGGTAGG - Intergenic
1030981132 7:116186419-116186441 GATGACATGTTGATGGTGGCAGG - Intergenic
1033421905 7:141211126-141211148 GATGACAGGATGAAGGTATGAGG + Intronic
1033859808 7:145610734-145610756 TACTACATGATGAAAGTTGGGGG - Intergenic
1037004061 8:13754733-13754755 GATTACATTCTGAAGAAGGGTGG + Intergenic
1039779729 8:40772598-40772620 AATAAGATGATGAAGGTGGAAGG - Intronic
1043798676 8:84579041-84579063 GATGACATGTTGATGGTGGGAGG - Intronic
1044163511 8:88950470-88950492 GATTAAATGTTGACTGTGGGTGG - Intergenic
1045288240 8:100810206-100810228 GATGCCACGATGAAGGTGGGAGG + Intergenic
1046170906 8:110504370-110504392 GGTTACAAGAGGAAGGAGGGTGG - Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046802332 8:118442177-118442199 GAATACATGGTGAAGATGGGAGG + Intronic
1047139335 8:122119297-122119319 GATTACAAAAGGAAGGAGGGTGG + Intergenic
1048036816 8:130684920-130684942 GATTACAGGAATGAGGTGGGAGG + Intergenic
1051207365 9:14702378-14702400 GATTTCATGATGACAGTTGGTGG - Intergenic
1052193535 9:25684645-25684667 GATTGGATCATGAGGGTGGGTGG + Intergenic
1052462438 9:28783309-28783331 GATTATATGAAGAATATGGGAGG - Intergenic
1056879715 9:90379662-90379684 GATGACATGCTGCAGGGGGGTGG - Intergenic
1059080388 9:111242962-111242984 GCTTACCTGAGGAAGGAGGGTGG + Intergenic
1059186860 9:112282087-112282109 GATTACATGATGAAGGTGGGTGG - Intronic
1060918824 9:127406415-127406437 GATTACTTGCTGCAGCTGGGAGG + Intronic
1061764602 9:132873889-132873911 TATTACATGGTACAGGTGGGAGG - Intronic
1062130115 9:134888030-134888052 GGTTACATGAGGCAGGTGTGAGG + Intergenic
1186309593 X:8303053-8303075 GTCTACATGAAGAAGGTGAGTGG - Intergenic
1187675731 X:21714595-21714617 GTATAAATGATGAGGGTGGGGGG - Intronic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1192167656 X:68835799-68835821 GTCTACATGATGGAGGAGGGGGG - Intronic
1193662080 X:84269565-84269587 TAATATATGTTGAAGGTGGGAGG + Intergenic
1195160221 X:102163518-102163540 TATCACACGATGAAAGTGGGAGG + Intergenic
1195802297 X:108726456-108726478 GACTTCATCATGGAGGTGGGTGG + Intronic
1196830708 X:119773351-119773373 GATTACAGAATCAAGGCGGGTGG + Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1201365645 Y:13203993-13204015 GAGTACATTTTGGAGGTGGGAGG - Intergenic