ID: 1059188027

View in Genome Browser
Species Human (GRCh38)
Location 9:112294584-112294606
Sequence CTTGTTCTTAATTGCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059188027_1059188030 22 Left 1059188027 9:112294584-112294606 CCTCCATTGCAATTAAGAACAAG 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1059188030 9:112294629-112294651 ACTGTTATTCAACTCATTTATGG No data
1059188027_1059188031 25 Left 1059188027 9:112294584-112294606 CCTCCATTGCAATTAAGAACAAG 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1059188031 9:112294632-112294654 GTTATTCAACTCATTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059188027 Original CRISPR CTTGTTCTTAATTGCAATGG AGG (reversed) Intronic
901017076 1:6238029-6238051 CTTGATCTCATTTCCAATGGAGG - Intergenic
908108455 1:60871361-60871383 CCTGCTTCTAATTGCAATGGTGG + Intronic
908288402 1:62635768-62635790 ATTGTTTTTAGTAGCAATGGCGG + Intronic
908606986 1:65808635-65808657 CTTTATCTTAATGGCAGTGGGGG + Intronic
908826806 1:68141157-68141179 CTTGTTGTTAAGTGGAATGTTGG - Intronic
909988046 1:82186483-82186505 TTTGTTTGTAATTGCAATTGGGG + Intergenic
910004139 1:82374420-82374442 CATTTTCTTAATGACAATGGTGG + Intergenic
910624312 1:89290478-89290500 TTTGTTTTTATTTGAAATGGTGG + Intergenic
914338837 1:146740899-146740921 CTGGATCTTAATTGCGGTGGTGG - Intergenic
918336697 1:183522329-183522351 CATTTTCTTGATTGCAATGGTGG - Intronic
922634105 1:227147816-227147838 TTTGTTCTTAATTGGTATGATGG - Intronic
923998202 1:239520639-239520661 GTAGTTCTTTATTGCAATGCAGG + Intronic
1069656951 10:70097052-70097074 CTTTTTTTTAATTGGCATGGTGG + Intronic
1070079238 10:73168934-73168956 CTGGTGCTTAATTGCAGAGGTGG - Intronic
1071100588 10:82032455-82032477 CTATTTTTTAAATGCAATGGAGG + Intronic
1073990083 10:109252730-109252752 CTGGTTCTTGAGTACAATGGAGG - Intergenic
1074340967 10:112629462-112629484 TTTCTTCTTAATTCCAATGTGGG - Intronic
1081309816 11:41556080-41556102 CATGTTATTAAGTGTAATGGTGG - Intergenic
1081733935 11:45390782-45390804 CTTGTTCTTCACAGCCATGGTGG - Intergenic
1082678297 11:56137385-56137407 CTTGTTCTTTATTGTATCGGAGG - Exonic
1082695615 11:56360558-56360580 CTTGTTCTTTATTGTATCGGAGG + Exonic
1089797659 11:120995251-120995273 CTTATTATTAATAGCAATGAGGG + Intergenic
1089818106 11:121194801-121194823 CTTGTACTTCATTGCAATTTGGG + Intergenic
1089896051 11:121930948-121930970 GTTGTTCTTATTTGCCTTGGTGG + Intergenic
1094386045 12:29895358-29895380 CTACTTCTAAAATGCAATGGTGG + Intergenic
1095544364 12:43347376-43347398 CTGGATCTTAGTTGCAAGGGAGG + Intergenic
1095702298 12:45202729-45202751 CTTGTCCTCAATTGCTATGCAGG - Intergenic
1098571386 12:71991623-71991645 CTTGATCTTAATTCCAATATTGG + Intronic
1099143107 12:79005332-79005354 CATGTTCTTAATATCCATGGGGG - Intronic
1099701586 12:86090106-86090128 CTTGTTCTTAATTTCATTCAGGG + Intronic
1113430076 13:110242138-110242160 CTGGTTCTTAAATGAAAGGGAGG + Intronic
1113508078 13:110830872-110830894 CTTGATCTTATTTGCCCTGGCGG + Intergenic
1113609385 13:111632530-111632552 CAAGTTCTTATTTGCAAAGGAGG + Intronic
1114420298 14:22576760-22576782 TTTGTTGTTAATTGCATTGTAGG - Intronic
1118699500 14:68419459-68419481 CTTGTAATTGATTGCAATGTGGG - Intronic
1123976522 15:25559177-25559199 CTGATTTTTAATTGCAGTGGGGG + Intergenic
1129600526 15:76995731-76995753 CTTGGTCTTAATTGTCATGGAGG + Intronic
1130670804 15:85910801-85910823 TTTGTTCTTGATTTCAAAGGTGG - Intergenic
1131488462 15:92841697-92841719 TGTCTTCTTCATTGCAATGGAGG - Intergenic
1131621782 15:94075656-94075678 CTTGTTCTGAATTGCACAGATGG - Intergenic
1132008988 15:98257578-98257600 CTTGTTTTGAGTAGCAATGGAGG - Intergenic
1133432649 16:5751714-5751736 CTCTTACTTAATTGCAATAGTGG - Intergenic
1133892663 16:9895494-9895516 CTTGTGTTTATTTGGAATGGAGG + Intronic
1137934947 16:52625845-52625867 ATTTTCCTTCATTGCAATGGTGG - Intergenic
1139061804 16:63262651-63262673 CTTGTTCTTGATTTCATAGGAGG + Intergenic
1139995442 16:70976453-70976475 CTGGATCTTAATTGCGGTGGTGG + Intronic
1142166788 16:88595196-88595218 CTTTTTCTTAACTGGAATGTCGG - Intronic
1146412715 17:32601514-32601536 ATTGTTATTAACTGCTATGGTGG - Intronic
1147948130 17:44092007-44092029 CTTGGACTTAATTGCATTGAAGG - Intronic
1151098425 17:71526894-71526916 ATTATTCTTAATTGCAGTGGTGG + Intergenic
1153091076 18:1343886-1343908 TTTTTTCTTAATTGTAGTGGTGG + Intergenic
1153624063 18:7006514-7006536 CTTGTTTTTAATTGCAGTACTGG - Intronic
1155332082 18:24728649-24728671 CTTGTTCTTAACTGTGATAGAGG - Intergenic
1155543437 18:26889489-26889511 ATTGTTCTTAATATCAAGGGTGG + Intergenic
1155903878 18:31425871-31425893 CTTGTTCTCATTTGCACTGAAGG - Intergenic
1157777164 18:50404694-50404716 CTTCCTCTTAATTGCAAAGAGGG + Intergenic
1161564343 19:4991699-4991721 CTGTATCTTGATTGCAATGGTGG - Intronic
1163189210 19:15664110-15664132 CTTGTCCTTTGGTGCAATGGTGG - Intergenic
1166245630 19:41523565-41523587 ATTGTTCTTAATATCCATGGGGG - Intergenic
1166247885 19:41543409-41543431 GTTGTTATTAATTGCTCTGGTGG - Intergenic
1168275764 19:55277491-55277513 CTTGCTCCTTATGGCAATGGAGG + Intronic
925294251 2:2767252-2767274 CTTGTCCTTAATCAGAATGGAGG - Intergenic
926668345 2:15549817-15549839 CTTGTACTTAAGTGCCATGATGG - Intronic
927229642 2:20809429-20809451 CAAGTTCTTAATTCTAATGGAGG - Intronic
928316449 2:30250306-30250328 CTTGCTCTTTTTTGCAAAGGTGG - Intronic
930650781 2:53962427-53962449 CCTGTTGTTAATTGAAGTGGAGG - Intronic
931724332 2:65094274-65094296 CTTGTTTTTAATTAAAATAGGGG - Intronic
935866779 2:107395933-107395955 CTTTTTCATAATGGTAATGGAGG + Intergenic
945724120 2:213454090-213454112 CTTGTTTTTAATAGCAAACGGGG + Intronic
946895175 2:224317033-224317055 CTTTATCTTGATTGCAATGGTGG + Intergenic
1170006165 20:11671612-11671634 GTTGTTCTTAACTGCACTGGAGG + Intergenic
1170098821 20:12676026-12676048 CTTCTTCTTAATTGCATTATGGG + Intergenic
1174876572 20:54232708-54232730 CTGTTCCTTCATTGCAATGGTGG - Intergenic
1175265527 20:57701163-57701185 CCTGTTGTTAATGGGAATGGGGG - Intronic
1180204754 21:46252171-46252193 CTTGTTCTTAATTGGGCAGGAGG + Intronic
1180985584 22:19902326-19902348 CTTGTTCAAAATTGGAATGGGGG + Intronic
1181890862 22:26062356-26062378 CTTGTTCTTTCTTTCACTGGGGG + Intergenic
1182578928 22:31292085-31292107 TTTGTTCTTAATGGCAAAGATGG + Intronic
949426278 3:3919913-3919935 CATGTTCTTAATGTAAATGGTGG + Intronic
949529262 3:4938079-4938101 CTTGTTGTTACATTCAATGGAGG - Intergenic
950746130 3:15090880-15090902 CTTTATCTTAATTGGAGTGGTGG + Intronic
952041702 3:29268872-29268894 CTTGATCTTAACTGCCATAGTGG - Intergenic
952088723 3:29858038-29858060 CTTTTTCTTAATTTCAAAGATGG - Intronic
953919475 3:46942075-46942097 CTTGTTCTCAGGTGCACTGGGGG + Intronic
956452109 3:69385470-69385492 CTTCTTTTTAATTTCATTGGGGG - Intronic
959712048 3:109395288-109395310 CTTGTTCTTAGATGCACTGTCGG + Intergenic
960942538 3:122944020-122944042 CTTGTTCTCAAATGCAAATGTGG + Intronic
963008850 3:140750931-140750953 TTTGATCTGACTTGCAATGGTGG - Intergenic
970497669 4:16643204-16643226 CTTTTTCCTAATTCCAATGGAGG + Intronic
973795382 4:54420107-54420129 CTTCTTTTTATATGCAATGGGGG + Intergenic
973868228 4:55136356-55136378 CCTATTCTTAATTGCAAAGGTGG - Intergenic
975527115 4:75362913-75362935 CTAGTTCTTATTTGGAATGGGGG + Intergenic
977807666 4:101321967-101321989 CTTATTCTTAATTGGAGTTGAGG - Intronic
978709274 4:111758413-111758435 TTTGTTCATAATCGAAATGGAGG + Intergenic
986708318 5:10469543-10469565 CTTTTCCTTAATTGCAGTGTGGG + Intronic
987156244 5:15092321-15092343 TTTATTCCTAACTGCAATGGAGG - Intergenic
988056740 5:26106736-26106758 GTTGTTCTTAAGTTCAGTGGTGG - Intergenic
988441485 5:31238851-31238873 TTTGTTCTTACTGGCAATGTAGG + Intronic
995651670 5:114376701-114376723 CTTTTTCTTAAACACAATGGGGG + Intronic
996869508 5:128172443-128172465 CTGTATCTTTATTGCAATGGTGG - Intronic
998687011 5:144539413-144539435 CTTGTTCTGAGTTGCACTTGGGG + Intergenic
998902671 5:146872567-146872589 CTTGAGCTTATTTGGAATGGGGG + Intronic
1000457182 5:161464952-161464974 CTGCTTCTTAATAGCAGTGGTGG + Intronic
1004303400 6:14478470-14478492 CTATTTCTTAATTCTAATGGAGG - Intergenic
1004830510 6:19472590-19472612 CTAATTCCTAATTGCAATGGAGG - Intergenic
1005768917 6:29045055-29045077 CTTCTACTTAATTACATTGGTGG - Exonic
1006079566 6:31557670-31557692 CTTATTCTTTATTCCCATGGCGG - Exonic
1007905568 6:45457164-45457186 TTTGTTCTGAATTGCTCTGGTGG + Intronic
1008180432 6:48321336-48321358 CTTGTTATTAATTGCAACTCTGG - Intergenic
1008369781 6:50719114-50719136 CTTGTTCTCAATGGCCAAGGTGG + Exonic
1009225952 6:61020233-61020255 ATTGTTCTTAATTTCAGTGAAGG - Intergenic
1009363120 6:62838029-62838051 ATTGTTCTTAATTTCAGTGAAGG + Intergenic
1014637594 6:123867278-123867300 CTTGTTCTTAATGGCATAAGTGG - Intronic
1016016789 6:139194448-139194470 CTTGTCAGTAATTGAAATGGGGG - Intergenic
1016338796 6:143038553-143038575 CTTGTTATTAATTGCTACTGGGG + Intergenic
1018106474 6:160492121-160492143 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018107323 6:160501529-160501551 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG + Intronic
1019821502 7:3246593-3246615 CTTGTTACTAATTCCAGTGGGGG + Intergenic
1022352083 7:29575885-29575907 CTTGTTCTCAGTTGGGATGGAGG + Intergenic
1023703479 7:42915005-42915027 CTTGCTCTTCTTTGCAATGGGGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1026081787 7:67228046-67228068 CTCATTCTTAACTGCAATGTGGG + Intronic
1027736318 7:81937085-81937107 ATTGTTATTGATTGCAAAGGAGG - Intergenic
1028773922 7:94657604-94657626 CTTGTGCTTGATTGAAGTGGCGG + Intronic
1030270682 7:107665355-107665377 CATGTTCTTAATCACAAAGGTGG + Intronic
1030560622 7:111080164-111080186 CTTGGTGTTAATTGAAATGTAGG + Intronic
1030802717 7:113872334-113872356 TTTGTTTTTAAGTGAAATGGTGG - Intergenic
1031968129 7:128042820-128042842 CTTGTTTTTAATGCCACTGGAGG + Intronic
1032056110 7:128685596-128685618 CTTGTTTTTAATTTTACTGGAGG - Intronic
1038318030 8:26503900-26503922 TTTTTTCTAAAGTGCAATGGGGG - Intronic
1040660456 8:49569347-49569369 CTGTGTCTTAATTGCACTGGTGG + Intergenic
1041461917 8:58120627-58120649 CTTATTCTTATCTGCAGTGGAGG - Intronic
1041582479 8:59477507-59477529 CTTGTTCTTAGATGGGATGGAGG + Intergenic
1045719436 8:105090882-105090904 ATTGGTGTTAATTTCAATGGTGG - Intronic
1050023215 9:1306679-1306701 CTCCTTCTTCATTGCCATGGAGG - Intergenic
1051970497 9:22881134-22881156 CTTGGGCTGAAGTGCAATGGTGG - Intergenic
1056615989 9:88166252-88166274 CTTTTTCTTTCTTGAAATGGTGG - Intergenic
1059130728 9:111746188-111746210 CTTGTTCTGAATTGCAACATGGG + Intronic
1059188027 9:112294584-112294606 CTTGTTCTTAATTGCAATGGAGG - Intronic
1060306954 9:122422115-122422137 CATGGATTTAATTGCAATGGAGG - Intergenic
1193894586 X:87097617-87097639 CTTTTTCTGAATTTCAATGTTGG + Intergenic
1194116104 X:89900211-89900233 CTACTTCTAAAATGCAATGGTGG - Intergenic
1194217887 X:91153721-91153743 CTTTGTCTTAATTGCAGTGCAGG - Intergenic
1194679758 X:96837735-96837757 ATAATTCTTAATTGAAATGGCGG + Intronic
1194941602 X:100016921-100016943 CTACCTCTTAATTACAATGGGGG - Intergenic
1197238537 X:124096186-124096208 TTTCTTCCTAATGGCAATGGGGG - Intronic
1198367887 X:135960608-135960630 TTTATTCTTAAATGCAAAGGTGG + Intergenic
1199329391 X:146541833-146541855 CTATTTCTTTATAGCAATGGAGG - Intergenic
1199893944 X:152114903-152114925 CTTGGGCATGATTGCAATGGAGG - Intergenic
1200018560 X:153182983-153183005 CCTGGTCATGATTGCAATGGAGG + Exonic
1200468902 Y:3557336-3557358 CTACTTCTAAAATGCAATGGTGG - Intergenic
1200554393 Y:4617510-4617532 CTTTGTCTTAATTGCAGTGCAGG - Intergenic