ID: 1059191807

View in Genome Browser
Species Human (GRCh38)
Location 9:112333746-112333768
Sequence GAGGGTGGGCGCGAGCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059191807_1059191822 13 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191822 9:112333782-112333804 CCGGCCTCCGGCTCAGCTCTGGG No data
1059191807_1059191820 12 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191820 9:112333781-112333803 GCCGGCCTCCGGCTCAGCTCTGG No data
1059191807_1059191817 1 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191817 9:112333770-112333792 CCCCGCTGGCAGCCGGCCTCCGG No data
1059191807_1059191823 14 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191823 9:112333783-112333805 CGGCCTCCGGCTCAGCTCTGGGG No data
1059191807_1059191826 30 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191826 9:112333799-112333821 TCTGGGGCGCCCTCTTCCCGCGG No data
1059191807_1059191813 -6 Left 1059191807 9:112333746-112333768 CCCCTGCGCTCGCGCCCACCCTC No data
Right 1059191813 9:112333763-112333785 ACCCTCGCCCCGCTGGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059191807 Original CRISPR GAGGGTGGGCGCGAGCGCAG GGG (reversed) Intergenic