ID: 1059191862

View in Genome Browser
Species Human (GRCh38)
Location 9:112333938-112333960
Sequence CCGCGGGGCCGCGGGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059191862_1059191878 9 Left 1059191862 9:112333938-112333960 CCCGCCCTCCCGCGGCCCCGCGG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191862_1059191874 -1 Left 1059191862 9:112333938-112333960 CCCGCCCTCCCGCGGCCCCGCGG No data
Right 1059191874 9:112333960-112333982 GGCCTTCCGGCTTCGCAGACCGG No data
1059191862_1059191875 0 Left 1059191862 9:112333938-112333960 CCCGCCCTCCCGCGGCCCCGCGG No data
Right 1059191875 9:112333961-112333983 GCCTTCCGGCTTCGCAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059191862 Original CRISPR CCGCGGGGCCGCGGGAGGGC GGG (reversed) Intergenic