ID: 1059191878

View in Genome Browser
Species Human (GRCh38)
Location 9:112333970-112333992
Sequence CTTCGCAGACCGGGCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059191873_1059191878 -8 Left 1059191873 9:112333955-112333977 CCGCGGGCCTTCCGGCTTCGCAG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191857_1059191878 21 Left 1059191857 9:112333926-112333948 CCGCGCACCCCGCCCGCCCTCCC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191860_1059191878 13 Left 1059191860 9:112333934-112333956 CCCGCCCGCCCTCCCGCGGCCCC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191855_1059191878 29 Left 1059191855 9:112333918-112333940 CCGCTCCGCCGCGCACCCCGCCC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191867_1059191878 4 Left 1059191867 9:112333943-112333965 CCTCCCGCGGCCCCGCGGGCCTT No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191861_1059191878 12 Left 1059191861 9:112333935-112333957 CCGCCCGCCCTCCCGCGGCCCCG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191854_1059191878 30 Left 1059191854 9:112333917-112333939 CCCGCTCCGCCGCGCACCCCGCC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191859_1059191878 14 Left 1059191859 9:112333933-112333955 CCCCGCCCGCCCTCCCGCGGCCC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191869_1059191878 0 Left 1059191869 9:112333947-112333969 CCGCGGCCCCGCGGGCCTTCCGG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191872_1059191878 -7 Left 1059191872 9:112333954-112333976 CCCGCGGGCCTTCCGGCTTCGCA No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191862_1059191878 9 Left 1059191862 9:112333938-112333960 CCCGCCCTCCCGCGGCCCCGCGG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191864_1059191878 8 Left 1059191864 9:112333939-112333961 CCGCCCTCCCGCGGCCCCGCGGG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191866_1059191878 5 Left 1059191866 9:112333942-112333964 CCCTCCCGCGGCCCCGCGGGCCT No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191871_1059191878 -6 Left 1059191871 9:112333953-112333975 CCCCGCGGGCCTTCCGGCTTCGC No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191868_1059191878 1 Left 1059191868 9:112333946-112333968 CCCGCGGCCCCGCGGGCCTTCCG No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data
1059191856_1059191878 24 Left 1059191856 9:112333923-112333945 CCGCCGCGCACCCCGCCCGCCCT No data
Right 1059191878 9:112333970-112333992 CTTCGCAGACCGGGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059191878 Original CRISPR CTTCGCAGACCGGGCCTGCC AGG Intergenic