ID: 1059194149

View in Genome Browser
Species Human (GRCh38)
Location 9:112354980-112355002
Sequence CACCCACATCTCCCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059194149_1059194154 21 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194154 9:112355024-112355046 ACTGGGCACCAGGAGGAATTAGG No data
1059194149_1059194155 24 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194155 9:112355027-112355049 GGGCACCAGGAGGAATTAGGTGG No data
1059194149_1059194150 3 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194150 9:112355006-112355028 TTAACATAATAGTTATTTACTGG No data
1059194149_1059194153 14 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194153 9:112355017-112355039 GTTATTTACTGGGCACCAGGAGG No data
1059194149_1059194151 4 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194151 9:112355007-112355029 TAACATAATAGTTATTTACTGGG No data
1059194149_1059194152 11 Left 1059194149 9:112354980-112355002 CCTGTCTTTGGGAGATGTGGGTG No data
Right 1059194152 9:112355014-112355036 ATAGTTATTTACTGGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059194149 Original CRISPR CACCCACATCTCCCAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr