ID: 1059194952

View in Genome Browser
Species Human (GRCh38)
Location 9:112362260-112362282
Sequence TTGTTGCTCAGGTGCAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059194952_1059194954 1 Left 1059194952 9:112362260-112362282 CCATGGTTGCACCTGAGCAACAA No data
Right 1059194954 9:112362284-112362306 GTAAGACCCTGTCTAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059194952 Original CRISPR TTGTTGCTCAGGTGCAACCA TGG (reversed) Intergenic
No off target data available for this crispr