ID: 1059195649

View in Genome Browser
Species Human (GRCh38)
Location 9:112368681-112368703
Sequence TGGAGTGTATGCAGCACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059195648_1059195649 -9 Left 1059195648 9:112368667-112368689 CCAAAGGGATGGATTGGAGTGTA No data
Right 1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG No data
1059195641_1059195649 28 Left 1059195641 9:112368630-112368652 CCCATTATAATTTCATAAGGGGA No data
Right 1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG No data
1059195647_1059195649 -8 Left 1059195647 9:112368666-112368688 CCCAAAGGGATGGATTGGAGTGT No data
Right 1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG No data
1059195642_1059195649 27 Left 1059195642 9:112368631-112368653 CCATTATAATTTCATAAGGGGAC No data
Right 1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059195649 Original CRISPR TGGAGTGTATGCAGCACTAG TGG Intergenic
No off target data available for this crispr