ID: 1059196505

View in Genome Browser
Species Human (GRCh38)
Location 9:112375860-112375882
Sequence GACAGCTCTTAGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059196505_1059196509 16 Left 1059196505 9:112375860-112375882 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1059196509 9:112375899-112375921 GTTATCTGCAGAAGAAGGCAGGG No data
1059196505_1059196507 11 Left 1059196505 9:112375860-112375882 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1059196507 9:112375894-112375916 GAGTAGTTATCTGCAGAAGAAGG 0: 178
1: 192
2: 102
3: 110
4: 247
1059196505_1059196508 15 Left 1059196505 9:112375860-112375882 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059196505 Original CRISPR GACAGCTCTTAGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr